RNA id: TU306165



Basic Information


Item Value
RNA id TU306165
length 214
lncRNA type inter_gene
GC content 0.60
exon number 1
gene id G269811
representative True

Chromosome Information


Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 3968428 ~ 3968641 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TGGGGAGCCACGTACAACGGCATGCAGTGTCAGGTCTGTGGACAGGGCCAGCTCTGCTGTCACCTGTCAGATGAGTCTCCCCCTATCTCTAGGCTGGAGCCATCCCAGGGACTCCATATGCGCACTGCCCACGGCCAGTCCATATGTGTATTTCCACGTAATTCCTCCCCGGCAGGGTAGGTTGTGGCCTCCACAGCGTCCCCTATGGGTTCGC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU306160 lncRNA upstream 5265 3962941 ~ 3963163 (+) True G269806
TU306145 lncRNA upstream 25237 3942981 ~ 3943191 (+) True G269791
TU306144 lncRNA upstream 25750 3942353 ~ 3942678 (+) True G269790
TU306100 lncRNA upstream 58515 3909677 ~ 3909913 (+) True G269746
TU306088 lncRNA upstream 63938 3904091 ~ 3904490 (+) True G269734
TU306168 lncRNA downstream 7434 3976075 ~ 3976395 (+) True G269814
TU306190 lncRNA downstream 43607 4012248 ~ 4012477 (+) True G269833
TU306268 lncRNA downstream 265049 4233690 ~ 4234687 (+) True G269907
TU306269 lncRNA downstream 266414 4235055 ~ 4235333 (+) True G269908
TU306273 lncRNA downstream 275558 4244199 ~ 4244541 (+) True G269912
CI01000065_03815841_03816140.mRNA mRNA upstream 151838 3812858 ~ 3816590 (+) True CI01000065_03815841_03816140
CI01000065_03709249_03716992.mRNA mRNA upstream 250520 3709144 ~ 3717908 (+) True CI01000065_03709249_03716992
CI01000065_03692428_03692874.mRNA mRNA upstream 275008 3692428 ~ 3693420 (+) True CI01000065_03692428_03692874
CI01000065_03486630_03494354.mRNA mRNA upstream 472688 3486567 ~ 3495740 (+) True CI01000065_03486630_03494354
CI01000065_03398558_03399971.mRNA mRNA upstream 568003 3398558 ~ 3400425 (+) True CI01000065_03398558_03399971
CI01000065_03980525_03983765.mRNA mRNA downstream 11884 3980525 ~ 3984923 (+) True CI01000065_03980525_03983765
CI01000065_03986974_04006773.mRNA mRNA downstream 18333 3986974 ~ 4007259 (+) True CI01000065_03986974_04006773
CI01000065_04008274_04010105.mRNA mRNA downstream 39633 4008274 ~ 4010194 (+) True CI01000065_04008274_04010105
CI01000065_04044257_04051771.mRNA mRNA downstream 75616 4044257 ~ 4052283 (+) True CI01000065_04044257_04051771
CI01000065_04081314_04103789.mRNA mRNA downstream 112673 4081314 ~ 4103961 (+) True CI01000065_04081314_04103789
TU305478 other upstream 415304 3552804 ~ 3553124 (+) False G269225
TU305428 other upstream 505500 3458957 ~ 3462928 (+) True G269181
TU304991 other upstream 1330223 2608907 ~ 2638205 (+) True G268805
TU304676 other upstream 1728430 2239159 ~ 2239998 (+) True G268525
TU303653 other upstream 2885773 1082153 ~ 1082655 (+) True G267577

Expression Profile


TU306165 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU306165 Expression in each Bioproject

Bar chart with 38 bars.
TU306165 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.