RNA id: TU346880



Basic Information


Item Value
RNA id TU346880
length 208
lncRNA type inter_gene
GC content 0.35
exon number 1
gene id G305284
representative True

Chromosome Information


Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2972237 ~ 2972444 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GTTTTGGTTGTGACATTGTTTTTTGAGTGTTATTCGATAAAATTTAGTTTTTATGTTTGTACAACTGTTCAGAACTGTGCTAGCTAACCATGTGCTGATTAGCATGTTTGAGCTAGGCTCAAAAGTATCTAAAATTGTCACAACCGAAACTTCACCACATGTTTCGGTAATGACATCATTGTTTTGGTAGTGACAAAAAGGAACACAT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU346866 lncRNA upstream 57857 2914079 ~ 2914380 (+) True G305270
TU346861 lncRNA upstream 71269 2900690 ~ 2900968 (+) True G305265
TU346736 lncRNA upstream 89005 2878272 ~ 2883232 (+) False G305148
TU346737 lncRNA upstream 89005 2878272 ~ 2883232 (+) True G305148
TU346858 lncRNA upstream 94398 2877432 ~ 2877839 (+) True G305262
TU346881 lncRNA downstream 78 2972522 ~ 2972808 (+) True G305285
TU346727 lncRNA downstream 79420 3051864 ~ 3076118 (+) True G305146
TU346933 lncRNA downstream 122705 3095149 ~ 3095387 (+) True G305336
TU346965 lncRNA downstream 183225 3155669 ~ 3156083 (+) True G305366
TU346975 lncRNA downstream 211319 3183763 ~ 3183984 (+) True G305376
CI01000092_02958119_02966042.mRNA mRNA upstream 5774 2958024 ~ 2966463 (+) True CI01000092_02958119_02966042
CI01000092_02818349_02838255.mRNA mRNA upstream 133982 2817620 ~ 2838255 (+) True CI01000092_02818349_02838255
CI01000092_02739990_02745224.mRNA mRNA upstream 226990 2739990 ~ 2745247 (+) True CI01000092_02739990_02745224
CI01000092_02721458_02724152.mRNA mRNA upstream 248085 2721393 ~ 2724152 (+) True CI01000092_02721458_02724152
CI01000092_02661524_02662121.mRNA mRNA upstream 310064 2661383 ~ 2662173 (+) False CI01000092_02661524_02662121
CI01000092_02977237_02979350.mRNA mRNA downstream 4793 2977237 ~ 2979378 (+) True CI01000092_02977237_02979350
CI01000092_03007267_03029327.mRNA mRNA downstream 34823 3007267 ~ 3029327 (+) True CI01000092_03007267_03029327
CI01000092_03080030_03082866.mRNA mRNA downstream 107118 3079562 ~ 3083624 (+) False CI01000092_03080030_03082866
CI01000092_03329908_03348045.mRNA mRNA downstream 357464 3329908 ~ 3348319 (+) True CI01000092_03329908_03348045
CI01000092_03433283_03442900.mRNA mRNA downstream 460839 3433283 ~ 3442960 (+) True CI01000092_03433283_03442900
TU346472 other upstream 654003 2317792 ~ 2318234 (+) True G304938
TU345140 other upstream 1655714 1315443 ~ 1316523 (+) True G303768
TU347218 other downstream 694864 3667308 ~ 3667965 (+) True G305584
TU347240 other downstream 753903 3726347 ~ 3861333 (+) False G305596

Expression Profile


TU346880 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU346880 Expression in each Bioproject

Bar chart with 26 bars.
TU346880 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.