RNA id: TU399865



Basic Information


Item Value
RNA id TU399865
length 538
lncRNA type inter_gene
GC content 0.43
exon number 2
gene id G351131
representative True

Chromosome Information


Item Value
chromosome id CI01000140
NCBI id null
chromosome length 2494207
location 2230925 ~ 2243732 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CTGATGAGTTTGGAGAACACCTGACAAGAGATCAGAGATCATTCCTTCATGCAGAATCTCTCCAGATCCTTCAGATTCCCAGCTCCATGTTGGTGCTTCTTCTCTTCAGTTCACTCCACTCATTTTCTTTAGGGTTCAGGTCAGGGGACTGGGACGGTCATGGCAGAAGCTTCATTTTGTGCTCAGTGACACATTTTTGTGTTGGTTTTGATGTTGTTTTGGATCATTGTCCTGATGGAAGATCTAACCACGGCCCATTATTGGATTTCTAGCAGAAGTGGTCAGGTTTTGATTTTTTATCTGTTGGTATTTGATAGAATCCATGATGCCATGTATCTGAACAAGATGTCCAGGACCTCCAGCAGAAAAATAGGCCCACAACATTAAAGATCCAGCAGTATATTTAACCGTGGGCATGGGGTACTTTTTATCCATGTGTGCACCAAACCCATCTGGTGGTTTTGCTGCCAAAAAGCTCTTTTTGTAGTTTCATCTGACCATAAAAGCCGGTCCCGTTTGAAGTTCCAGTCGTGTCTGA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU399838 lncRNA upstream 13470 2209109 ~ 2217455 (+) True G351110
TU399756 lncRNA upstream 46823 2107425 ~ 2184102 (+) True G351048
TU399793 lncRNA upstream 149055 2081635 ~ 2081870 (+) True G351080
TU399749 lncRNA upstream 163174 1989994 ~ 2067751 (+) True G351044
TU399754 lncRNA upstream 209544 1988989 ~ 2021381 (+) True G351046
TU399922 lncRNA downstream 117247 2360979 ~ 2361807 (+) True G351176
TU399929 lncRNA downstream 150846 2394578 ~ 2448529 (+) True G351183
TU399936 lncRNA downstream 159307 2403039 ~ 2427246 (+) False G351188
TU399938 lncRNA downstream 159307 2403039 ~ 2427246 (+) True G351188
TU399949 lncRNA downstream 162634 2406366 ~ 2469539 (+) True G351191
CI01000140_02228806_02229324.mRNA mRNA upstream 1283 2228691 ~ 2229642 (+) True CI01000140_02228806_02229324
CI01000140_02121231_02124634.mRNA mRNA upstream 106286 2121231 ~ 2124639 (+) True CI01000140_02121231_02124634
CI01000140_02075636_02092672.mRNA mRNA upstream 137857 2074686 ~ 2093068 (+) False CI01000140_02075636_02092672
CI01000140_01948258_01949562.mRNA mRNA upstream 280834 1948258 ~ 1950091 (+) True CI01000140_01948258_01949562
CI01000140_01885335_01887127.mRNA mRNA upstream 343173 1885258 ~ 1887752 (+) True CI01000140_01885335_01887127
CI01000140_02283016_02291094.mRNA mRNA downstream 39244 2282976 ~ 2291420 (+) True CI01000140_02283016_02291094
CI01000140_02322058_02325171.mRNA mRNA downstream 78259 2321991 ~ 2325225 (+) True CI01000140_02322058_02325171
TU399506 other upstream 654806 1569266 ~ 1576119 (+) True G350848
TU399412 other upstream 695351 1280388 ~ 1485928 (+) True G350770
TU399573 other upstream 705753 1515978 ~ 1525172 (+) True G350901
TU399486 other upstream 723217 1504386 ~ 1507708 (+) True G350832
TU399393 other upstream 1190117 1039556 ~ 1040808 (+) True G350762

Expression Profile


TU399865 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

TU399865 Expression in each Bioproject

Bar chart with 44 bars.
TU399865 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.