RNA id: TU399929



Basic Information


Item Value
RNA id TU399929
length 545
lncRNA type inter_gene
GC content 0.42
exon number 3
gene id G351183
representative True

Chromosome Information


Item Value
chromosome id CI01000140
NCBI id null
chromosome length 2494207
location 2394578 ~ 2448529 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


ATACGATCCTCAATTGGATGGAACTGGAATAAATACTTTTAATGTTGCGATCCTATTGGACTTATGATAGCAACCTGAATTGTAACAAAGCACTGTTGGCCAGAGGAGAACTGGCCCCCCGACTAAGCCTGGTTTCTCCCAAGGTTTTTTTCTCCATTTTAACACCTGTTTGCCACCTGATGTCACCTGATGGAGTTTGGGTTCCTTGCCGCTGTCACCTTTGGCTTGCTTAGTTGGGGACATTTGACTTGACATTTGATATTCAACAGTGCTTTGATCTGCCTGCACTGACACCATTTTCTTCTAGAGCTGCTGTGCAGCCACACGTTTTCACATTTGGCTCCTAAACTCTGGAATAGCCTTCCTGATAATGTTCGGGGCTCAGACTCGCTCACCCAGTTTAAATCTAGATTAAAGACGCATCTCTTTAGCCAAGCATTCACATAATGCATCTCATATCAGATCAATTGCACATGACTATCTTTACTTAATGTTATGAACAGCAGCTACGCTAATTATTCTCCAGTTGCTTTTCTGTTTTATCT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU399922 lncRNA upstream 32771 2360979 ~ 2361807 (+) True G351176
TU399865 lncRNA upstream 150846 2230925 ~ 2243732 (+) True G351131
TU399838 lncRNA upstream 177123 2209109 ~ 2217455 (+) True G351110
TU399756 lncRNA upstream 210476 2107425 ~ 2184102 (+) True G351048
TU399793 lncRNA upstream 312708 2081635 ~ 2081870 (+) True G351080
CI01000140_02322058_02325171.mRNA mRNA upstream 69353 2321991 ~ 2325225 (+) True CI01000140_02322058_02325171
CI01000140_02283016_02291094.mRNA mRNA upstream 103158 2282976 ~ 2291420 (+) True CI01000140_02283016_02291094
CI01000140_02228806_02229324.mRNA mRNA upstream 164936 2228691 ~ 2229642 (+) True CI01000140_02228806_02229324
CI01000140_02121231_02124634.mRNA mRNA upstream 269939 2121231 ~ 2124639 (+) True CI01000140_02121231_02124634
CI01000140_02075636_02092672.mRNA mRNA upstream 301510 2074686 ~ 2093068 (+) False CI01000140_02075636_02092672
TU399506 other upstream 818459 1569266 ~ 1576119 (+) True G350848
TU399412 other upstream 859004 1280388 ~ 1485928 (+) True G350770
TU399573 other upstream 869406 1515978 ~ 1525172 (+) True G350901
TU399486 other upstream 886870 1504386 ~ 1507708 (+) True G350832
TU399393 other upstream 1353770 1039556 ~ 1040808 (+) True G350762

Expression Profile


TU399929 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

TU399929 Expression in each Bioproject

Bar chart with 41 bars.
TU399929 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.