Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU410866

Basic Information

Item	Value
RNA id	TU410866
length	225
lncRNA type	inter_gene
GC content	0.40
exon number	1
gene id	G360223
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000152
NCBI id	null
chromosome length	3381324
location	3171827 ~ 3172051 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

CACTGGATTTGCACAAAAGATTAATGGCACATGCTAGTCGATGAGTTGAATCAACTCCACAGCAACTACATAAATTTATCCACTAACCATTTAGAAACATCCAGTTGCATTCTAAAAGTTGTAACTTCTTCCTGAGTCTCTCCATCAATGTCCGACTCCGGTTTGAACAATGTAATGCTGAACACCGTTACTGACAACCCTCATTTTGGCTTTGTGAGATTCTCC

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU410707	lncRNA	downstream	105958	3049567 ~ 3065869 (-)	True	G360074
TU410708	lncRNA	downstream	121756	3029318 ~ 3050071 (-)	False	G360074
TU410702	lncRNA	downstream	153397	3018171 ~ 3018430 (-)	True	G360070
TU410701	lncRNA	downstream	153937	3017616 ~ 3017890 (-)	True	G360069
TU410700	lncRNA	downstream	154384	3017216 ~ 3017443 (-)	True	G360068
TU410982	lncRNA	upstream	180633	3352684 ~ 3356085 (-)	True	G360332
CI01000152_02440117_02451100.mRNA	mRNA	downstream	720005	2440117 ~ 2451822 (-)	True	CI01000152_02440117_02451100
CI01000152_02427978_02434593.mRNA	mRNA	downstream	737234	2427519 ~ 2434593 (-)	True	CI01000152_02427978_02434593
CI01000152_02334753_02345817.mRNA	mRNA	downstream	826010	2334168 ~ 2345817 (-)	True	CI01000152_02334753_02345817
CI01000152_02190690_02206511.mRNA	mRNA	downstream	965169	2190682 ~ 2206658 (-)	True	CI01000152_02190690_02206511
CI01000152_02086974_02089993.mRNA	mRNA	downstream	1081777	2086488 ~ 2090050 (-)	False	CI01000152_02086974_02089993
TU410417	other	downstream	711991	2368992 ~ 2459836 (-)	True	G359800
TU410397	other	downstream	853093	2318268 ~ 2318734 (-)	True	G359788
TU409936	other	downstream	1146989	2024633 ~ 2024838 (-)	True	G359374
TU409927	other	downstream	1278368	1890858 ~ 1893459 (-)	True	CI01000152_01892421_01893463
TU409694	other	downstream	1827822	1337660 ~ 1344005 (-)	True	G359178

Expression Profile