Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU453020

Basic Information

Item	Value
RNA id	TU453020
length	237
lncRNA type	inter_gene
GC content	0.32
exon number	1
gene id	G395356
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000225
NCBI id	null
chromosome length	750214
location	536852 ~ 537088 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

AAACACTTCAACTCTGGAGGTGGTTTATGTGAAACTCTTCTCTTACATGCACACTAAAATGCTTGTTTCATTCTTGACAATAATCTGTCAGAGATTCAGACAATAATCTGACAGAAAATCTGGGATTTTCTTTGTCCATGCCTTAATGAAGGGGTTTTAATCAAAAAATAAAAATAAAAACGCAAGAATAAAGTAATTCAATACTTTTGCTGCTCCCCAACATAACAGAAAAAATAT

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU452993	lncRNA	downstream	5362	510889 ~ 531490 (-)	False	G395337
TU452990	lncRNA	downstream	5362	524213 ~ 531490 (-)	True	G395337
TU452997	lncRNA	downstream	13984	462156 ~ 522868 (-)	False	G395340
TU452998	lncRNA	downstream	13984	462156 ~ 522868 (-)	False	G395340
TU453001	lncRNA	downstream	13984	462156 ~ 522868 (-)	False	G395340
TU453021	lncRNA	upstream	645	537733 ~ 538115 (-)	True	G395357
TU453027	lncRNA	upstream	11021	548109 ~ 548339 (-)	True	G395363
TU453046	lncRNA	upstream	103855	640943 ~ 671296 (-)	True	G395379
TU453035	lncRNA	upstream	112556	649644 ~ 676472 (-)	False	G395371
TU453038	lncRNA	upstream	112722	649810 ~ 676622 (-)	True	G395371
CI01000225_00425270_00431446.mRNA	mRNA	downstream	105406	424599 ~ 431446 (-)	True	CI01000225_00425270_00431446
CI01000225_00404519_00407448.mRNA	mRNA	downstream	128223	404375 ~ 408629 (-)	True	CI01000225_00404519_00407448
CI01000225_00393863_00402338.mRNA	mRNA	downstream	134314	393863 ~ 402538 (-)	True	CI01000225_00393863_00402338
CI01000225_00383340_00392393.mRNA	mRNA	downstream	144459	383087 ~ 392393 (-)	True	CI01000225_00383340_00392393
CI01000225_00195825_00204991.mRNA	mRNA	downstream	331861	195709 ~ 204991 (-)	True	CI01000225_00195825_00204991
CI01000225_00553926_00616121.mRNA	mRNA	upstream	16838	553926 ~ 616121 (-)	True	CI01000225_00553926_00616121
CI01000225_00724320_00725003.mRNA	mRNA	upstream	187213	724301 ~ 725325 (-)	False	CI01000225_00724320_00725003

Expression Profile