RNA id: TCONS_00019381


Basic Information

Item Value
RNA id TCONS_00019381
length 268
RNA type mRNA
GC content 0.59
exon number 2
gene id XLOC_009664
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 5678071 ~ 5710821 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCTCCACTCTGCCTCGTGTTCTTCCTCTGTGTTCTCCGTGTCGTGTGGAGGCTATGTTCGCTCACTCCTCTGAGTCCTGTGATGGAGATCCGGCTGGCGGAGGAGGCTCCTGTCTGCTGTCCTTCCAACCCGGAGACACACTTGGCCTGCTGATCAGTGAACCCCGAGACGGTTGGCACTACGGGCAGAACGAACGCACCGGACGAAAAGGCTGGTTTCCCTTCTCCTACACGCAGCCGTGCCCGAACACTCCTGGACAAGACATCAG

Function

GO:

id name namespace
GO:0051764 actin crosslink formation biological_process
GO:2000251 positive regulation of actin cytoskeleton reorganization biological_process
GO:0007009 plasma membrane organization biological_process
GO:0051017 actin filament bundle assembly biological_process
GO:0030838 positive regulation of actin filament polymerization biological_process
GO:0005829 cytosol cellular_component
GO:0005654 nucleoplasm cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-070112-1902 Predicted to be involved in actin filament organization and positive regulation of cytoskeleton organization. Predicted to act upstream of or within plasma membrane organization. Predicted to be active in cytosol and nucleoplasm.

Ensembl:

ensembl_id ENSDART00000138330

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00021681 lncRNA upstream 200050 5499274 ~ 5502699 (+) True XLOC_009659
TCONS_00019372 lncRNA upstream 205986 5496172 ~ 5496763 (+) True XLOC_009658
TCONS_00021878 lncRNA upstream 991021 4708735 ~ 4711728 (+) False XLOC_009650
TCONS_00021879 lncRNA upstream 991021 4708822 ~ 4711728 (+) True XLOC_009650
TCONS_00019349 lncRNA upstream 995081 4706841 ~ 4707668 (+) True XLOC_009649
TCONS_00021880 lncRNA downstream 689457 6395303 ~ 6421449 (+) False XLOC_009668
TCONS_00021881 lncRNA downstream 689458 6395304 ~ 6412819 (+) False XLOC_009668
TCONS_00021882 lncRNA downstream 695745 6401591 ~ 6412819 (+) True XLOC_009668
TCONS_00021682 lncRNA downstream 1044901 6750747 ~ 6757298 (+) False XLOC_009671
TCONS_00019401 lncRNA downstream 1238721 6944567 ~ 6947921 (+) True XLOC_009673
TCONS_00019380 mRNA upstream 2356 5678139 ~ 5700393 (+) False XLOC_009664
TCONS_00019379 mRNA upstream 11511 5678072 ~ 5691238 (+) False XLOC_009664
TCONS_00019377 mRNA upstream 66373 5612659 ~ 5636376 (+) True XLOC_009663
TCONS_00019376 mRNA upstream 66374 5612547 ~ 5636375 (+) False XLOC_009663
TCONS_00019375 mRNA upstream 97408 5597600 ~ 5605341 (+) True XLOC_009662
TCONS_00019382 mRNA downstream 69131 5774977 ~ 5779201 (+) True XLOC_009665
TCONS_00019383 mRNA downstream 193032 5898878 ~ 6182429 (+) False XLOC_009666
TCONS_00019384 mRNA downstream 195989 5901835 ~ 6182429 (+) False XLOC_009666
TCONS_00019385 mRNA downstream 196450 5902296 ~ 6051511 (+) False XLOC_009666
TCONS_00019386 mRNA downstream 202637 5908483 ~ 5921819 (+) False XLOC_009666
TCONS_00019367 other upstream 255975 5276676 ~ 5446774 (+) False XLOC_009658
TCONS_00019368 other upstream 262694 5382382 ~ 5440055 (+) False XLOC_009658
TCONS_00019369 other upstream 265975 5408651 ~ 5436774 (+) False XLOC_009658
TCONS_00019362 other upstream 471352 5184402 ~ 5231397 (+) False XLOC_009657
TCONS_00019358 other upstream 828268 4874364 ~ 4874481 (+) True XLOC_009654
TCONS_00019392 other downstream 1024660 6730506 ~ 6733636 (+) False XLOC_009670
TCONS_00019438 other downstream 3531286 9237132 ~ 9237246 (+) True XLOC_009699
TCONS_00019442 other downstream 3820261 9526107 ~ 9527209 (+) False XLOC_009704
TCONS_00019443 other downstream 3834187 9540033 ~ 9558103 (+) True XLOC_009705
TCONS_00019455 other downstream 4578412 10284258 ~ 10292937 (+) True XLOC_009713

Expression Profile

//