RNA id: TCONS_00019529


Basic Information

Item Value
RNA id TCONS_00019529
length 673
lncRNA type retained_intron
GC content 0.56
exon number 4
gene id XLOC_009761
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 12730311 ~ 12756528 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCTGCCAATAATAACCATATTTAAAGCACCCTAAATCTGCTGCCTTCGCTAATTGCCATCATAAAATAGAAATATTGGTTATTTTCTCTAAAGTATAATGACACACATTCAACTAGGGCCCTTCCTCTGCACAGTTTCTGCACATTTTCCCTCACTTCTTCACTCACACCTGTCCTCATCCTGCCCCCCCTCATTCAGACTACACATGACCCTCTGGAAGATGCAGAGATCCGCTACGCACTCACAATCAGCCAGGAGACCCACCAACAGGAGGAGCGTCTGCGCAGGGGAGACGACCTGAGGCTGCAGATGGCCATCGAGGAGAGTAAGAGGGAGAAAACCAAGCCCGAGGAGTCGTCTCTGATGGAGTTAAGCGCTGCAGACCCGTGGGGAGCTCCTGCGACAGGCTCTGCAGGACCCTCTCCTCCTCCTGCTTTGGGTCCCGCATCTACTGCTGGCCCTTGGGGACCTCCTGATCCATGGGGAGCCACTTCCCCTGCCTCTCCCCCGAGTGCTGATCCTTGGGCAGGAGCACCAGCAACCGTAGCTCCAGACCCATGGAGTGATTCGTCCTCCAGAGTAAATTCTGACCCCTGGGCATCCACAGCTGTGACCCCACCAAGTGCCGACCCTTGGGCTCACTCAGTGGCTCCGGCCCCTACGCCGCTCTCAG

Function

GO:

id name namespace
GO:0006897 endocytosis biological_process
GO:0005768 endosome cellular_component
GO:0030125 clathrin vesicle coat cellular_component
GO:0005886 plasma membrane cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0005543 phospholipid binding molecular_function
GO:0030276 clathrin binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2680 Predicted to enable clathrin binding activity and phospholipid binding activity. Predicted to be involved in endocytosis. Predicted to be located in cytoplasm. Predicted to be part of clathrin vesicle coat. Predicted to be active in endosome and plasma membrane. Orthologous to human EPN1 (epsin 1).

Ensembl:

ensembl_id ENSDART00000145583

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00019528 lncRNA upstream 2934 12740912 ~ 12744284 (+) False XLOC_009761
TCONS_00019512 lncRNA upstream 501094 12243583 ~ 12246124 (+) True XLOC_009752
TCONS_00021898 lncRNA upstream 607882 12117631 ~ 12139336 (+) True XLOC_009751
TCONS_00021897 lncRNA upstream 628692 12117631 ~ 12118526 (+) False XLOC_009751
TCONS_00019501 lncRNA upstream 1037720 11708510 ~ 11709498 (+) True XLOC_009744
TCONS_00021899 lncRNA downstream 214042 12962960 ~ 12963877 (+) True XLOC_009764
TCONS_00021688 lncRNA downstream 363346 13112264 ~ 13115609 (+) True XLOC_009765
TCONS_00021900 lncRNA downstream 419954 13168872 ~ 13172698 (+) True XLOC_009766
TCONS_00021689 lncRNA downstream 750443 13499361 ~ 13501965 (+) True XLOC_009768
TCONS_00021901 lncRNA downstream 863736 13612654 ~ 13614188 (+) True XLOC_009769
TCONS_00019524 mRNA upstream 81566 12660477 ~ 12665652 (+) True XLOC_009760
TCONS_00019523 mRNA upstream 107465 12632428 ~ 12639753 (+) False XLOC_009759
TCONS_00019522 mRNA upstream 107465 12632428 ~ 12639753 (+) True XLOC_009759
TCONS_00019521 mRNA upstream 130063 12611362 ~ 12617155 (+) True XLOC_009758
TCONS_00019520 mRNA upstream 186876 12521872 ~ 12560342 (+) True XLOC_009757
TCONS_00019530 mRNA downstream 63296 12812214 ~ 12820810 (+) False XLOC_009762
TCONS_00019531 mRNA downstream 63554 12812472 ~ 12821768 (+) True XLOC_009762
TCONS_00019532 mRNA downstream 87225 12836143 ~ 12866551 (+) True XLOC_009763
TCONS_00019533 mRNA downstream 675616 13424534 ~ 13453818 (+) False XLOC_009767
TCONS_00019536 mRNA downstream 679049 13427967 ~ 13452967 (+) True XLOC_009767
TCONS_00019518 other upstream 366372 12380730 ~ 12380846 (+) True XLOC_009756
TCONS_00019517 other upstream 446932 12300169 ~ 12300286 (+) True XLOC_009755
TCONS_00019511 other upstream 501322 12241490 ~ 12245896 (+) False XLOC_009752
TCONS_00019500 other upstream 1043881 11700646 ~ 11703337 (+) False XLOC_009744
TCONS_00019483 other upstream 1456335 11242560 ~ 11290883 (+) False XLOC_009731
TCONS_00019534 other downstream 675630 13424548 ~ 13441633 (+) False XLOC_009767
TCONS_00019535 other downstream 675633 13424551 ~ 13441595 (+) False XLOC_009767
TCONS_00019585 other downstream 3117306 15866224 ~ 15867165 (+) True XLOC_009800
TCONS_00019587 other downstream 3405406 16154324 ~ 16154458 (+) True XLOC_009803
TCONS_00019609 other downstream 4768030 17516948 ~ 17517082 (+) True XLOC_009816

Expression Profile

//