RNA id: TCONS_00019597


Basic Information

Item Value
RNA id TCONS_00019597
length 446
RNA type mRNA
GC content 0.55
exon number 3
gene id XLOC_009809
representative False

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 16849220 ~ 16945650 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGAAGAAACTGAAAGAAGTTTTGATGCAAGTGGAGGATGAAAGAAGGCATGCAGATCAATACAGAGAGCAGTTGGATAAGTCTATGGGGCGCCTCCGTCAACTGAAGAGGCAGCTAGAGGAGGTAGAAGAAGAGAACTCTCGCTCCAATGCCCAGCGCAGGAAACTACAGCGAGAGCTGGAGGAAATGAGCGACAGCATGCAGAGCATGAACCGCGAGCTCAACACTCTCCGCTCCCAACTCAGGAGAGCTCCGCTCCCTCTGTCCATGCGTGCTGGTCGCAGAGCTCTAGTTGATGACCTTTCTCAGGAGAACTCTGATTCTGAAGATCCAGGTGCTTCTCCCACACCGTCCAGCGGCCCACCGGGTACCCCCACACCCTCAGACAACGCCCTGGGCCCCCCTCCCCCGTACAGCCTTACAGATGCTGAATAAGAAGGGGCGAGA

Function

GO:

id name namespace
GO:0016459 myosin complex cellular_component
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0051015 actin filament binding molecular_function
GO:0003774 motor activity molecular_function
GO:0003779 actin binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-100921-1 Predicted to enable ATP binding activity; actin filament binding activity; and cytoskeletal motor activity. Predicted to be part of myosin complex. Human ortholog(s) of this gene implicated in autosomal dominant nonsyndromic deafness 4A and sensorineural hearing loss. Orthologous to human MYH14 (myosin heavy chain 14).

Ensembl:

ensembl_id ENSDART00000173163

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00021699 lncRNA upstream 218584 16708151 ~ 16714418 (+) True XLOC_009807
TCONS_00021908 lncRNA upstream 284127 16644679 ~ 16648875 (+) True XLOC_009806
TCONS_00019586 lncRNA upstream 873194 16055484 ~ 16059808 (+) True XLOC_009802
TCONS_00021907 lncRNA upstream 932260 15999747 ~ 16000742 (+) True XLOC_009801
TCONS_00019584 lncRNA upstream 1222919 15709411 ~ 15710083 (+) True XLOC_009799
TCONS_00021909 lncRNA downstream 64913 17004014 ~ 17004375 (+) True XLOC_009811
TCONS_00021910 lncRNA downstream 361052 17300153 ~ 17302519 (+) True XLOC_009814
TCONS_00021911 lncRNA downstream 609690 17548791 ~ 17551059 (+) True XLOC_009817
TCONS_00021700 lncRNA downstream 661776 17600877 ~ 17601900 (+) True XLOC_009819
TCONS_00021701 lncRNA downstream 726661 17665762 ~ 17666461 (+) False XLOC_009820
TCONS_00019593 mRNA upstream 93505 16824678 ~ 16839497 (+) False XLOC_009808
TCONS_00019594 mRNA upstream 93505 16826504 ~ 16839497 (+) True XLOC_009808
TCONS_00019592 mRNA upstream 378872 16529748 ~ 16554130 (+) True XLOC_009805
TCONS_00019590 mRNA upstream 628855 16265850 ~ 16304147 (+) False XLOC_009804
TCONS_00019599 mRNA downstream 29581 16968682 ~ 16975264 (+) False XLOC_009810
TCONS_00019600 mRNA downstream 29959 16969060 ~ 16974789 (+) False XLOC_009810
TCONS_00019601 mRNA downstream 29985 16969086 ~ 16991746 (+) False XLOC_009810
TCONS_00019602 mRNA downstream 38685 16977786 ~ 16991808 (+) False XLOC_009810
TCONS_00019603 mRNA downstream 38703 16977804 ~ 16991799 (+) False XLOC_009810
TCONS_00019587 other upstream 778544 16154324 ~ 16154458 (+) True XLOC_009803
TCONS_00019585 other upstream 1065837 15866224 ~ 15867165 (+) True XLOC_009800
TCONS_00019534 other upstream 3491369 13424548 ~ 13441633 (+) False XLOC_009767
TCONS_00019535 other upstream 3491407 13424551 ~ 13441595 (+) False XLOC_009767
TCONS_00019518 other upstream 4552156 12380730 ~ 12380846 (+) True XLOC_009756
TCONS_00019609 other downstream 577847 17516948 ~ 17517082 (+) True XLOC_009816
TCONS_00019610 other downstream 631709 17570810 ~ 17570934 (+) True XLOC_009818
TCONS_00019630 other downstream 2126244 19065345 ~ 19128471 (+) False XLOC_009830
TCONS_00019642 other downstream 2765323 19704424 ~ 19704538 (+) True XLOC_009838
TCONS_00019651 other downstream 3228733 20167834 ~ 20170828 (+) True XLOC_009843

Expression Profile

//