RNA id: TCONS_00019602



Basic Information


Item Value
RNA id TCONS_00019602
length 642
RNA type mRNA
GC content 0.49
exon number 7
gene id XLOC_009810
representative False

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 16968682 ~ 16991808 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CTTCCTTTTCCCTTTTCACTTTGAGTCCAAGATGGGAGTTGACATCAGACACAACAAGGACCGCAAGGTTCACAGGAAGGAGCCCAAAAGTCAGGATATTTACCTGAGGCTCTTGGTCAAGTTGTACAGATTCCTGTCTCGTCGTTCTGATGCTCCCTTCAACAAGGTTATTCTGAGGAGACTCTTCATGAGCAAGACCAACCGCCCACCTCTGGCTCTCTCCCGACTGATTCGTAAGATGAAGCTTCCAGGTCGTGAAAACCTGACTGCTGTTGTTGTGGGAACTATTACTGATGATGTCAGGATTCAGAATATCCCTAAACTGAAGGTGTGCGCTCTAAAAGTGACTGACCGCGCTCGCAGCAGGATCTTGAAGGCTGGTGGACAGATCATGACCTTTGATCAGCTGGCACTTACTTCACCCAGAGGACGGGGCACCGTTCTGTTGTCAGGACCCCGCAAGGGCAGACAGGTGTACAGGCATTTTGGGAAAGCTCCTGGAACCCCTCACAGCCACACCAAGCCCTATGTGCGCTCCAAAGGCAGGAAGTTCGAGCGTGCCCGTGGTCGCAGACACTAAGGATACAAGAATTTTTCGTATTCAGTGTTGTAATCAAAATAAAGATTGGGTAATGTTCAAAA

Function


GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005737 cytoplasm cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-040801-165 Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome and rough endoplasmic reticulum. Predicted to be part of cytosolic large ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 18. Orthologous to human RPL18 (ribosomal protein L18).

Ensembl:

ensembl_id ENSDART00000043173

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00019598 lncRNA upstream 42320 16933047 ~ 16935466 (+) True XLOC_009809
TCONS_00021699 lncRNA upstream 263368 16708151 ~ 16714418 (+) True XLOC_009807
TCONS_00021908 lncRNA upstream 328911 16644679 ~ 16648875 (+) True XLOC_009806
TCONS_00019586 lncRNA upstream 917978 16055484 ~ 16059808 (+) True XLOC_009802
TCONS_00021907 lncRNA upstream 977044 15999747 ~ 16000742 (+) True XLOC_009801
TCONS_00021909 lncRNA downstream 12206 17004014 ~ 17004375 (+) True XLOC_009811
TCONS_00021910 lncRNA downstream 308345 17300153 ~ 17302519 (+) True XLOC_009814
TCONS_00021911 lncRNA downstream 556983 17548791 ~ 17551059 (+) True XLOC_009817
TCONS_00021700 lncRNA downstream 609069 17600877 ~ 17601900 (+) True XLOC_009819
TCONS_00021701 lncRNA downstream 673954 17665762 ~ 17666461 (+) False XLOC_009820
TCONS_00019599 mRNA upstream 2522 16968682 ~ 16975264 (+) False XLOC_009810
TCONS_00019600 mRNA upstream 2997 16969060 ~ 16974789 (+) False XLOC_009810
TCONS_00019596 mRNA upstream 32136 16849242 ~ 16945650 (+) False XLOC_009809
TCONS_00019597 mRNA upstream 38685 16933002 ~ 16939101 (+) False XLOC_009809
TCONS_00019595 mRNA upstream 38697 16849220 ~ 16939089 (+) False XLOC_009809
TCONS_00019605 mRNA downstream 97306 17089114 ~ 17101441 (+) True XLOC_009812
TCONS_00019606 mRNA downstream 260679 17252487 ~ 17253389 (+) True XLOC_009813
TCONS_00019607 mRNA downstream 397308 17389116 ~ 17467462 (+) False XLOC_009815
TCONS_00019608 mRNA downstream 397327 17389135 ~ 17435647 (+) True XLOC_009815
TCONS_00019611 mRNA downstream 722856 17714664 ~ 17719700 (+) False XLOC_009822
TCONS_00019587 other upstream 823328 16154324 ~ 16154458 (+) True XLOC_009803
TCONS_00019585 other upstream 1110621 15866224 ~ 15867165 (+) True XLOC_009800
TCONS_00019534 other upstream 3536153 13424548 ~ 13441633 (+) False XLOC_009767
TCONS_00019535 other upstream 3536191 13424551 ~ 13441595 (+) False XLOC_009767
TCONS_00019518 other upstream 4596940 12380730 ~ 12380846 (+) True XLOC_009756
TCONS_00019609 other downstream 525140 17516948 ~ 17517082 (+) True XLOC_009816
TCONS_00019610 other downstream 579002 17570810 ~ 17570934 (+) True XLOC_009818
TCONS_00019630 other downstream 2073537 19065345 ~ 19128471 (+) False XLOC_009830
TCONS_00019642 other downstream 2712616 19704424 ~ 19704538 (+) True XLOC_009838
TCONS_00019651 other downstream 3176026 20167834 ~ 20170828 (+) True XLOC_009843

Expression Profile


//