RNA id: TCONS_00021700


Basic Information

Item Value
RNA id TCONS_00021700
length 345
lncRNA type inter_gene
GC content 0.40
exon number 2
gene id XLOC_009819
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 17600877 ~ 17601900 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

tgaaagggagttgtgttgcatctgcagtactgcattttggtcaataggtggagtaatatctgcacatgcgcagtttcaaaacaacacaggaagtaagaagattcaatccacaacgatcactctcagctcagcgccatattatgggaatcaaaagatgaagattacagtacaaattgagaacgtgcacaaagctttccccaatgtggacacacaggtttacagctcaacctctaaagtcccatatctggctgaggagactgtggatcatccaggtactatgcctttagatgcctatacacacattaaaatgatgtacagtaaaaattactagtaattttaactact

Function

GO:

id name namespace
GO:0007178 transmembrane receptor protein serine/threonine kinase signaling pathway biological_process
GO:0001706 endoderm formation biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0001711 endodermal cell fate commitment biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0001714 endodermal cell fate specification biological_process
GO:0016070 RNA metabolic process biological_process
GO:0007492 endoderm development biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0048785 hatching gland development biological_process
GO:0003401 axis elongation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0090036 regulation of protein kinase C signaling biological_process
GO:0003154 BMP signaling pathway involved in determination of left/right symmetry biological_process
GO:0035295 tube development biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0060429 epithelium development biological_process
GO:0035050 embryonic heart tube development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0048562 embryonic organ morphogenesis biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0048568 embryonic organ development biological_process
GO:0090092 regulation of transmembrane receptor protein serine/threonine kinase signaling pathway biological_process
GO:1903224 regulation of endodermal cell differentiation biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:1900094 regulation of transcription from RNA polymerase II promoter involved in determination of left/right symmetry biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0050789 regulation of biological process biological_process
GO:0061312 BMP signaling pathway involved in heart development biological_process
GO:1901166 neural crest cell migration involved in autonomic nervous system development biological_process
GO:1903045 neural crest cell migration involved in sympathetic nervous system development biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0060028 convergent extension involved in axis elongation biological_process
GO:0003303 BMP signaling pathway involved in heart jogging biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0035987 endodermal cell differentiation biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0042659 regulation of cell fate specification biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0072045 convergent extension involved in nephron morphogenesis biological_process
GO:0042663 regulation of endodermal cell fate specification biological_process
GO:1901213 regulation of transcription from RNA polymerase II promoter involved in heart development biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00021911 lncRNA upstream 49818 17548791 ~ 17551059 (+) True XLOC_009817
TCONS_00021910 lncRNA upstream 298358 17300153 ~ 17302519 (+) True XLOC_009814
TCONS_00021909 lncRNA upstream 596502 17004014 ~ 17004375 (+) True XLOC_009811
TCONS_00019598 lncRNA upstream 665411 16933047 ~ 16935466 (+) True XLOC_009809
TCONS_00021699 lncRNA upstream 886459 16708151 ~ 16714418 (+) True XLOC_009807
TCONS_00021701 lncRNA downstream 63862 17665762 ~ 17666461 (+) False XLOC_009820
TCONS_00021702 lncRNA downstream 63884 17665784 ~ 17666931 (+) True XLOC_009820
TCONS_00021912 lncRNA downstream 67400 17669300 ~ 17670457 (+) True XLOC_009821
TCONS_00021703 lncRNA downstream 900666 18502566 ~ 18512199 (+) True XLOC_009826
TCONS_00019622 lncRNA downstream 933756 18535656 ~ 18540899 (+) False XLOC_009827
TCONS_00019607 mRNA upstream 133415 17389116 ~ 17467462 (+) False XLOC_009815
TCONS_00019608 mRNA upstream 165230 17389135 ~ 17435647 (+) True XLOC_009815
TCONS_00019606 mRNA upstream 347488 17252487 ~ 17253389 (+) True XLOC_009813
TCONS_00019605 mRNA upstream 499436 17089114 ~ 17101441 (+) True XLOC_009812
TCONS_00019604 mRNA upstream 609069 16978424 ~ 16991808 (+) True XLOC_009810
TCONS_00019611 mRNA downstream 112764 17714664 ~ 17719700 (+) False XLOC_009822
TCONS_00019612 mRNA downstream 113343 17715243 ~ 17719694 (+) False XLOC_009822
TCONS_00019613 mRNA downstream 113477 17715377 ~ 17719792 (+) True XLOC_009822
TCONS_00019614 mRNA downstream 161948 17763848 ~ 17798412 (+) False XLOC_009823
TCONS_00019615 mRNA downstream 161995 17763895 ~ 17797950 (+) True XLOC_009823
TCONS_00019610 other upstream 29943 17570810 ~ 17570934 (+) True XLOC_009818
TCONS_00019609 other upstream 83795 17516948 ~ 17517082 (+) True XLOC_009816
TCONS_00019587 other upstream 1446419 16154324 ~ 16154458 (+) True XLOC_009803
TCONS_00019585 other upstream 1733712 15866224 ~ 15867165 (+) True XLOC_009800
TCONS_00019534 other upstream 4159244 13424548 ~ 13441633 (+) False XLOC_009767
TCONS_00019630 other downstream 1463445 19065345 ~ 19128471 (+) False XLOC_009830
TCONS_00019642 other downstream 2102524 19704424 ~ 19704538 (+) True XLOC_009838
TCONS_00019651 other downstream 2565934 20167834 ~ 20170828 (+) True XLOC_009843
TCONS_00019655 other downstream 2694923 20296823 ~ 20304275 (+) True XLOC_009845
TCONS_00019658 other downstream 2894873 20496773 ~ 20504865 (+) True XLOC_009846

Expression Profile

//