RNA id: CI01000304_10316482_10319012.mRNA



Basic Information


Item Value
RNA id CI01000304_10316482_10319012.mRNA
length 590
RNA type mRNA
GC content 0.51
exon number 4
gene id CI01000304_10316482_10319012
representative True

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 10316308 ~ 10319017 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CTTTTAAGAGAGGGGCCATTAACGCCAGTCCTCCGCTACACCAGCTCGAATGGCCCGCCACATGAAGGAACGGCCACGGGCGGGAGAGGATAGGCTGTAACAATGCATCTGAGGCAAATGCATCATTACTTACCCTAGCGGATTTGTAAACAGAAAACCGGCCCCAGACCGACCATGGTCCCCTTATTCGAACCTCTATTCATTACAAGCAGAACGTCGGTGCTGCTCGCCTTTCAGTGGTGTACGAGCGGCCCAGGAAATCTGGACGCCCATCGCTGGGTCGAGATCCAAGGTGCTCCGAGCTCTGTCACAGGCCAACTCATTCTGCTGATATATGACTGGCTCAAAAACAACCTTCAAGCTCTCAGGAAACCTGCCTGTTTTCAGAGTAAGAGATCAGATGGAGGACGAAGTGGTAACTTCGAGATTGATAGAAGCCAGACAGGCACAAGACTCTACCGAATGAGAAAGTGTCAGTCAGCCAGTTTATTGTGGCAGACACGGTTCTCACATGGCTGTGCTGTCAAGCATCTAAAGTCTAAACCTCAGGGACTGGGCCCTAAATTCACAGCCCATATGGTGTGAACGAA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU487340 lncRNA upstream 63036 10253047 ~ 10253272 (+) True G424376
TU487325 lncRNA upstream 73095 10242979 ~ 10243213 (+) True G424366
TU487310 lncRNA upstream 95193 10219120 ~ 10221115 (+) True G424351
TU487188 lncRNA upstream 99453 10153444 ~ 10216855 (+) True G424248
TU487294 lncRNA upstream 162904 10153184 ~ 10153404 (+) True G424337
TU487561 lncRNA downstream 140408 10459425 ~ 10460668 (+) True CI01000304_10451536_10470518
TU487534 lncRNA downstream 204244 10523261 ~ 10528247 (+) True G424546
TU487535 lncRNA downstream 204244 10523261 ~ 10525495 (+) False G424546
TU487537 lncRNA downstream 204244 10523261 ~ 10523469 (+) True G424546
TU487539 lncRNA downstream 213229 10532246 ~ 10535441 (+) True G424547
CI01000304_10292429_10311478.mRNA mRNA upstream 4580 10292429 ~ 10311728 (+) True CI01000304_10292429_10311478
CI01000304_10276598_10283032.mRNA mRNA upstream 32558 10276598 ~ 10283750 (+) True CI01000304_10276598_10283032
CI01000304_10256417_10260924.mRNA mRNA upstream 55384 10256223 ~ 10260924 (+) True CI01000304_10256417_10260924
CI01000304_10192819_10195110.mRNA mRNA upstream 121198 10192756 ~ 10195110 (+) False CI01000304_10192819_10195110
CI01000304_10189588_10190707.mRNA mRNA upstream 125331 10189588 ~ 10190977 (+) False CI01000304_10189588_10190707
CI01000304_10327313_10328936.mRNA mRNA downstream 8244 10327261 ~ 10329392 (+) True CI01000304_10327313_10328936
CI01000304_10451536_10470518.mRNA mRNA downstream 131393 10450410 ~ 10471255 (+) False CI01000304_10451536_10470518
CI01000304_10473174_10473651.mRNA mRNA downstream 153075 10472092 ~ 10473725 (+) True CI01000304_10473174_10473651
CI01000304_10489464_10500854.mRNA mRNA downstream 170364 10489381 ~ 10501137 (+) True CI01000304_10489464_10500854
CI01000304_10504058_10505899.mRNA mRNA downstream 183971 10502988 ~ 10506016 (+) True CI01000304_10504058_10505899
TU487195 other upstream 123413 10189315 ~ 10189404 (+) True G424251
TU487194 other upstream 124510 10188822 ~ 10189404 (+) False G424251
TU487178 other upstream 188986 10120399 ~ 10127322 (+) True G424246
TU486746 other upstream 750735 9564605 ~ 9565573 (+) True CI01000304_09564068_09565679
TU486477 other upstream 1366886 8949036 ~ 8949422 (+) True G423614
TU487556 other downstream 236269 10555614 ~ 10555704 (+) True G424559
TU488854 other downstream 2109688 12434972 ~ 12439086 (+) False CI01000304_12437868_12439019
TU488858 other downstream 2109688 12436554 ~ 12436605 (+) True G425718
TU488852 other downstream 2118787 12437804 ~ 12439086 (+) True CI01000304_12437868_12439019
TU489575 other downstream 3237434 13556451 ~ 13573943 (+) True G426349

Expression Profile


CI01000304_10316482_10319012.mRNA Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

CI01000304_10316482_10319012.mRNA Expression in each Bioproject

Bar chart with 29 bars.
CI01000304_10316482_10319012.mRNA Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.