RNA id: TU480043



Basic Information


Item Value
RNA id TU480043
length 253
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G417907
representative True

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 45537 ~ 45789 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TAACTACATTACCTCAGATGGATGAATGGTTGGATTCCACAACTGGTAAAATAAAACATATATAAGAAAATACAACATTTACTGTAGGAGCCATACAATTTACTGGTGACTTAATTTAAAAAAACTGTTCTATTGCGCTTCTGATTTGGCAGTGAAATTCGCCGATTTTGGGTGCGTAAGATGTGAAGGATTCTATGGTCCAGTTAGTATTTTCACCCCATAATGGCCGCCGCGCTACCGGCGCGCCATCCAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU480040 lncRNA upstream 19293 26033 ~ 26244 (+) True G417904
TU480033 lncRNA downstream 41171 86960 ~ 89259 (+) True G417900
TU480075 lncRNA downstream 89057 134846 ~ 135133 (+) True G417937
TU480077 lncRNA downstream 91345 137134 ~ 137405 (+) False G417939
TU480078 lncRNA downstream 91345 137134 ~ 137631 (+) True G417939
TU480081 lncRNA downstream 93424 139213 ~ 139451 (+) True G417941
CI01000304_00047400_00073206.mRNA mRNA downstream 533 46322 ~ 73338 (+) True CI01000304_00047400_00073206
CI01000304_00292894_00306187.mRNA mRNA downstream 247105 292894 ~ 306479 (+) True CI01000304_00292894_00306187
CI01000304_00308220_00310793.mRNA mRNA downstream 261884 307673 ~ 311267 (+) True CI01000304_00308220_00310793
CI01000304_00315935_00342330.mRNA mRNA downstream 268953 314742 ~ 342523 (+) False CI01000304_00315935_00342330
CI01000304_00370333_00419672.mRNA mRNA downstream 324544 370333 ~ 420755 (+) True CI01000304_00370333_00419672
TU480131 other downstream 180914 226703 ~ 227853 (+) True G417987
TU480224 other downstream 512303 558092 ~ 564451 (+) True G418059
TU480282 other downstream 826881 872670 ~ 875249 (+) True G418116
TU481280 other downstream 2046705 2092494 ~ 2093678 (+) True G418981
TU482914 other downstream 4257547 4303336 ~ 4303832 (+) True G420445

Expression Profile


TU480043 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU480043 Expression in each Bioproject

Bar chart with 39 bars.
TU480043 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.