Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU480492

Basic Information

Item	Value
RNA id	TU480492
length	217
lncRNA type	inter_gene
GC content	0.34
exon number	1
gene id	G418314
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000304
NCBI id	null
chromosome length	18613800
location	131766 ~ 131982 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

TGACTGGCCGCCACCTACTGGCGGTTTTAGTTTAATGCATAAAAGTATCAGTCCATTTTTACCATCATTTCATATTTCTCTACTTAACATTTTTTATTTAAAACATTTTCTCATAACATTATTTATGCCATTATGATTGCATTCATGCTACTTCTGAGCAGCATTAAACGTTGTGTATACATTTAGATCCAGCTTGTACCACTGTAGTGCAAAGATG

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU480478	lncRNA	downstream	86041	45503 ~ 45725 (-)	True	G418300
TU480472	lncRNA	downstream	105522	26033 ~ 26244 (-)	True	G418295
TU480468	lncRNA	upstream	46143	178125 ~ 251292 (-)	True	G418291
TU480453	lncRNA	upstream	153333	285315 ~ 342503 (-)	True	G418276
TU480448	lncRNA	upstream	160924	292906 ~ 306910 (-)	True	G418271
TU480457	lncRNA	upstream	192368	324350 ~ 330891 (-)	True	G418280
TU480451	lncRNA	upstream	215689	352828 ~ 353711 (-)	True	G418274
CI01000304_00088915_00116828.mRNA	mRNA	downstream	14938	88164 ~ 116828 (-)	True	CI01000304_00088915_00116828
CI01000304_00140443_00163606.mRNA	mRNA	upstream	7708	139690 ~ 163683 (-)	True	CI01000304_00140443_00163606
CI01000304_00167148_00268194.mRNA	mRNA	upstream	35166	167148 ~ 268194 (-)	True	CI01000304_00167148_00268194
CI01000304_00348539_00351333.mRNA	mRNA	upstream	216513	348495 ~ 351333 (-)	False	CI01000304_00348539_00351333
CI01000304_00670372_00671143.mRNA	mRNA	upstream	537294	669276 ~ 671143 (-)	True	CI01000304_00670372_00671143
CI01000304_00682765_00692613.mRNA	mRNA	upstream	550527	682509 ~ 692656 (-)	True	CI01000304_00682765_00692613
TU481692	other	upstream	2097402	2229384 ~ 2236106 (-)	False	G419353
TU481693	other	upstream	2097402	2229384 ~ 2236106 (-)	False	G419353
TU481701	other	upstream	2130520	2262502 ~ 2265185 (-)	False	G419354
TU481700	other	upstream	2130756	2262738 ~ 2265340 (-)	False	G419354
TU481699	other	upstream	2131110	2263092 ~ 2265185 (-)	False	G419354

Expression Profile