RNA id: TU483148



Basic Information


Item Value
RNA id TU483148
length 589
lncRNA type inter_gene
GC content 0.54
exon number 1
gene id G420655
representative True

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 4620122 ~ 4620710 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CCGAGAGACTCTTATTCAGGTGGGAGCGCGCACCAAGGCCCAGGCCGATCGCCACCGGCTGAAGCCTCCCGTATACGTCGTCGGACAAAAAGTGTGGCTTTCTTCCAGGAACATTCCGCTCCGCTCCGTATGTAATAAGTTGGCACCTAAATTCATTGGCCCGTTTACTGTCACCAAGATTCTTAGTCCGGTGACAGTCCGCCTCAAATTCCCCCCAGCGTACCGTAGAATTCACCCCGTATTCCACGTATCTAAAATCAAACCTGTTTTTCATGCTAACATTAATCCGCCGGTTCCGGTTCCCCCCCCGCCGCGTCTCGTAGATGGGGAACCCGTTTATTCGGTTCGTCGTATTTTGGACGCTAGGCGAAGGGGACGCGGATTCCAGTACTTGGTGGACTGGGAGGGTTACGGTCCGGAGGAGAGGAGTTGGGTTCCTGCCAGGGACATCCTGGATCACTCTCTTATTGATGATTACTATCAACAGGTAGGCTCTCCTGGGAGGGCCAGGAGGCGCTCGTAGGAGAGGGGGTACTGTCACGGTTCATGGATTCACTTACTCACCCTTGTGTGTTGTTGTGTGTGTGTG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU483134 lncRNA upstream 67594 4552066 ~ 4552528 (+) True G420642
TU482987 lncRNA upstream 310715 4308819 ~ 4309407 (+) True G420513
TU482978 lncRNA upstream 326183 4293565 ~ 4293939 (+) True G420504
TU482875 lncRNA upstream 344876 4233809 ~ 4275246 (+) True G420436
TU482886 lncRNA upstream 354921 4263448 ~ 4265201 (+) True G420438
TU483156 lncRNA downstream 11620 4632330 ~ 4632603 (+) True G420663
TU483048 lncRNA downstream 18753 4639463 ~ 4645086 (+) True G420556
TU483166 lncRNA downstream 49853 4670563 ~ 4670788 (+) True G420673
TU483046 lncRNA downstream 51724 4672434 ~ 4672940 (+) True G420554
TU483114 lncRNA downstream 164219 4784929 ~ 4785256 (+) True G420622
CI01000304_04563922_04573450.mRNA mRNA upstream 46672 4563709 ~ 4573450 (+) True CI01000304_04563922_04573450
CI01000304_04512680_04515061.mRNA mRNA upstream 103683 4512680 ~ 4516439 (+) True CI01000304_04512680_04515061
CI01000304_04461555_04498385.mRNA mRNA upstream 120434 4461186 ~ 4499688 (+) True CI01000304_04461555_04498385
CI01000304_04407815_04421342.mRNA mRNA upstream 198688 4407354 ~ 4421434 (+) True CI01000304_04407815_04421342
CI01000304_04381131_04396006.mRNA mRNA upstream 224047 4381131 ~ 4396075 (+) True CI01000304_04381131_04396006
CI01000304_04650911_04659754.mRNA mRNA downstream 30201 4650911 ~ 4660456 (+) True CI01000304_04650911_04659754
CI01000304_04679406_04680031.mRNA mRNA downstream 58590 4679300 ~ 4680037 (+) True CI01000304_04679406_04680031
CI01000304_04687431_04705845.mRNA mRNA downstream 66721 4687431 ~ 4705942 (+) True CI01000304_04687431_04705845
CI01000304_04708075_04768393.mRNA mRNA downstream 86695 4707405 ~ 4768581 (+) True CI01000304_04708075_04768393
CI01000304_04866074_04866590.mRNA mRNA downstream 244276 4864986 ~ 4867070 (+) True CI01000304_04866074_04866590
TU482914 other upstream 316290 4303336 ~ 4303832 (+) True G420445
TU481280 other upstream 2526444 2092494 ~ 2093678 (+) True G418981
TU480282 other upstream 3744873 872670 ~ 875249 (+) True G418116
TU480224 other upstream 4055671 558092 ~ 564451 (+) True G418059
TU480131 other upstream 4392269 226703 ~ 227853 (+) True G417987
TU483012 other downstream 552513 5173223 ~ 5173339 (+) True G420524
TU483706 other downstream 1620523 6241233 ~ 6242997 (+) True G421162
TU483945 other downstream 2731939 7352649 ~ 7354332 (+) True CI01000304_07352697_07354032
TU484021 other downstream 2863431 7484141 ~ 7484688 (+) True G421435
TU485573 other downstream 3357918 7978628 ~ 7978814 (+) True G422786

Expression Profile


TU483148 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU483148 Expression in each Bioproject

Bar chart with 44 bars.
TU483148 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1250.
End of interactive chart.

Homologous


species RNA id representative length rna type GC content exon number chromosome id location
zebrafish (Danio rerio) TCONS_00072874 True 5201 mRNA 0.50 1 NC_007120.7 14291932 ~ 14297132 (+)
rainbow trout (Oncorhynchus mykiss) TU2581725 True 939 lncRNA 0.49 1 NC_050571.1 17613455 ~ 17614393 (+)
tiger barb (Puntius tetrazona) TU225258 True 5114 lncRNA 0.51 2 NC_056720.1 13116438 ~ 13121691 (+)