RNA id: TU486991



Basic Information


Item Value
RNA id TU486991
length 451
lncRNA type antisense_over
GC content 0.45
exon number 1
gene id G424091
representative True

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 9301831 ~ 9302281 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TACCCACTTCATTATCAACATCTCTGTCCAAGAAAACTGAGTGGTTTTGATGCGAAAGATTTGCCGCGGATGATCAGTGATGGTTTCGTTAGGAAGGTTTTTGACTCCTGCGAAGCGGTCAGAGGCATTGAGAACAAGAAGACCGAGAAAGAGGGTGAATGAGACTGCGTGAGCTACAAACTTCATAAAGGGGCTGCGGAGAACCTGGCCCACCTGGAGAAAAGATTAAATGTAGAAATATATGTATCAACTGAAATAAAAGGGAAGCCTTCCCAATGTTATTAGATTACCTTGCTGCAGGGCATAATCCAATATGCAATGGCAAGAAATGGCAAGCCCACCATCACTCCCAGTACTGTCCAACATTTCACACCGATTGACGTTTGCCTGAGGCCTGATAAATTCTCGTACCACAGCGTCAGTAACTGTTGCTGGCAGTTAGGATGAGCCA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU486989 lncRNA downstream 5765 9295844 ~ 9296066 (-) True G424089
TU486988 lncRNA downstream 8708 9292696 ~ 9293123 (-) True G424088
TU486979 lncRNA downstream 38088 9263533 ~ 9263743 (-) True G424079
TU486975 lncRNA downstream 45484 9255908 ~ 9256347 (-) True G424075
TU486927 lncRNA downstream 85193 9216428 ~ 9216638 (-) True G424033
TU486946 lncRNA upstream 14378 9316659 ~ 9323420 (-) False G424051
TU486947 lncRNA upstream 14378 9316659 ~ 9374445 (-) True G424051
TU486952 lncRNA upstream 26053 9328334 ~ 9331490 (-) True G424054
TU487008 lncRNA upstream 58495 9360776 ~ 9459751 (-) False G424106
TU487012 lncRNA upstream 78211 9380492 ~ 9394406 (-) False G424110
CI01000304_09284328_09286980.mRNA mRNA downstream 14799 9284189 ~ 9287032 (-) True CI01000304_09284328_09286980
CI01000304_09046090_09129612.mRNA mRNA downstream 172219 9046090 ~ 9129612 (-) True CI01000304_09046090_09129612
CI01000304_08913076_08936241.mRNA mRNA downstream 365590 8912702 ~ 8936241 (-) True CI01000304_08913076_08936241
CI01000304_08904762_08909795.mRNA mRNA downstream 391341 8904478 ~ 8910490 (-) True CI01000304_08904762_08909795
CI01000304_08899490_08900383.mRNA mRNA downstream 401059 8899161 ~ 8900772 (-) True CI01000304_08899490_08900383
CI01000304_09342385_09345935.mRNA mRNA upstream 39573 9341854 ~ 9345935 (-) True CI01000304_09342385_09345935
CI01000304_09508090_09519201.mRNA mRNA upstream 205016 9507297 ~ 9519333 (-) True CI01000304_09508090_09519201
CI01000304_09566730_09575706.mRNA mRNA upstream 264449 9566730 ~ 9575706 (-) False CI01000304_09566730_09575706
CI01000304_09577749_09578512.mRNA mRNA upstream 273838 9576119 ~ 9578512 (-) True CI01000304_09577749_09578512
CI01000304_09609674_09619712.mRNA mRNA upstream 307229 9609510 ~ 9620030 (-) True CI01000304_09609674_09619712
TU486232 other downstream 436535 8862223 ~ 8865296 (-) True G423386
TU485601 other downstream 1649128 7630159 ~ 7652703 (-) True G422810
TU485117 other downstream 2518785 6744679 ~ 6783046 (-) True G422378
TU485082 other downstream 2670332 6631086 ~ 6631499 (-) True G422354
TU484958 other downstream 2818336 6477451 ~ 6479033 (-) True G422250
TU487066 other upstream 266075 9568356 ~ 9569034 (-) True CI01000304_09566730_09575706
TU487077 other upstream 434465 9739353 ~ 9739471 (-) True G424168
TU487428 other upstream 851165 10153446 ~ 10164330 (-) False G424458
TU487429 other upstream 851578 10153859 ~ 10164330 (-) True G424458
TU487433 other upstream 888293 10192696 ~ 10192895 (-) True G424459

Expression Profile


TU486991 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.08.
End of interactive chart.

TU486991 Expression in each Bioproject

Bar chart with 3 bars.
TU486991 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.25.
End of interactive chart.