RNA id: TU489723



Basic Information


Item Value
RNA id TU489723
length 226
lncRNA type inter_gene
GC content 0.35
exon number 1
gene id G426494
representative True

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 13485732 ~ 13485957 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GTCAAATGCGATAACTCCGCAACCATGGCACGTTCTGCAAAAGTGTAATCTATAATATCATTAAATAAATAGCATTATTGATAAATTATCAGTAGCCATATGAGACGGGATATAGTCGTTTATTCATTTGTATTTTTGTGTATGAACAAGCAGAAACACAGAGTGGTGATCCATGGATTTCAAACAGATAGAGGAATGATAAGACAGCACACACCTACATATCCAA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU489722 lncRNA upstream 154 13485377 ~ 13485578 (+) True G426493
TU489721 lncRNA upstream 729 13484632 ~ 13485003 (+) True G426492
TU489608 lncRNA upstream 30381 13453334 ~ 13455351 (+) True G426382
TU489550 lncRNA upstream 41285 13443277 ~ 13444447 (+) True G426324
TU489702 lncRNA upstream 55098 13430416 ~ 13430634 (+) True G426476
TU489724 lncRNA downstream 22 13485979 ~ 13486216 (+) True G426495
TU489726 lncRNA downstream 18835 13504792 ~ 13505142 (+) True G426497
TU489727 lncRNA downstream 28949 13514906 ~ 13515832 (+) True G426498
TU489586 lncRNA downstream 33467 13519424 ~ 13533081 (+) True G426360
TU489595 lncRNA downstream 33928 13519885 ~ 13525938 (+) True G426369
CI01000304_13435609_13438459.mRNA mRNA upstream 47002 13435507 ~ 13438730 (+) True CI01000304_13435609_13438459
CI01000304_13331382_13338351.mRNA mRNA upstream 146484 13331382 ~ 13339248 (+) True CI01000304_13331382_13338351
CI01000304_12828251_12839287.mRNA mRNA upstream 645741 12827314 ~ 12839991 (+) True CI01000304_12828251_12839287
CI01000304_12819247_12825161.mRNA mRNA upstream 660419 12817979 ~ 12825313 (+) True CI01000304_12819247_12825161
CI01000304_12744525_12773999.mRNA mRNA upstream 711420 12744059 ~ 12774312 (+) True CI01000304_12744525_12773999
CI01000304_13578347_13595075.mRNA mRNA downstream 92092 13578049 ~ 13595097 (+) False CI01000304_13578347_13595075
CI01000304_13613026_13686604.mRNA mRNA downstream 127069 13613026 ~ 13686604 (+) True CI01000304_13613026_13686604
CI01000304_13731299_13731640.mRNA mRNA downstream 245285 13731242 ~ 13731650 (+) True CI01000304_13731299_13731640
CI01000304_13744571_13748279.mRNA mRNA downstream 257718 13743675 ~ 13748318 (+) True CI01000304_13744571_13748279
CI01000304_13932457_13932762.mRNA mRNA downstream 445992 13931949 ~ 13933084 (+) True CI01000304_13932457_13932762
TU488854 other upstream 1046646 12434972 ~ 12439086 (+) False CI01000304_12437868_12439019
TU488858 other upstream 1046646 12436554 ~ 12436605 (+) True G425718
TU488852 other upstream 1046646 12437804 ~ 12439086 (+) True CI01000304_12437868_12439019
TU487556 other upstream 2930028 10555614 ~ 10555704 (+) True G424559
TU487195 other upstream 3292837 10189315 ~ 10189404 (+) True G424251
TU489575 other downstream 70494 13556451 ~ 13573943 (+) True G426349
TU489538 other downstream 844091 14330048 ~ 14330886 (+) True G426312
TU490061 other downstream 1462933 14948890 ~ 14950592 (+) True G426828
TU491290 other downstream 2399497 15885454 ~ 15889591 (+) True G427860
TU491458 other downstream 2597273 16083230 ~ 16083714 (+) True G428017

Expression Profile


TU489723 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

TU489723 Expression in each Bioproject

Bar chart with 23 bars.
TU489723 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.