RNA id: TU501222



Basic Information


Item Value
RNA id TU501222
length 239
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G436667
representative True

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 9896024 ~ 9896262 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TAAGATTTTGCACTTTGTTCTGGAAATTCTGGACACTTTCATTTCCATCTGCGTATATGAAAAAGAACGCAAACCATCTCATCTGGAGCAATTTTGAGCATGTACCTTTAAAAGCCCCGAGCGAAGATGCACCGATATTTTCACAAGGGGATCGACTTTATGCAACATTACTGTGGTTGAACCCACAGTGAACGACTAAAAGCGTGTGGTCGCTGTTATGAAGTGAGCTTAAACTCTCT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU501221 lncRNA downstream 6 9895783 ~ 9896018 (-) True G436666
TU501220 lncRNA downstream 282 9895518 ~ 9895742 (-) True G436665
TU501219 lncRNA downstream 741 9895042 ~ 9895283 (-) True G436664
TU501189 lncRNA downstream 2816 9892180 ~ 9893208 (-) True G436639
TU501178 lncRNA downstream 41343 9854226 ~ 9854681 (-) True G436631
TU501224 lncRNA upstream 6934 9903196 ~ 9903649 (-) True G436669
TU501223 lncRNA upstream 7684 9903946 ~ 9904572 (-) True G436668
TU501230 lncRNA upstream 67802 9964064 ~ 9964559 (-) True G436674
TU501236 lncRNA upstream 117173 10013435 ~ 10013659 (-) True G436680
TU501192 lncRNA upstream 181721 10077983 ~ 10109617 (-) True G436642
CI01000306_09887420_09890429.mRNA mRNA downstream 5595 9887140 ~ 9890429 (-) True CI01000306_09887420_09890429
CI01000306_09879930_09884435.mRNA mRNA downstream 10754 9878694 ~ 9885270 (-) True CI01000306_09879930_09884435
CI01000306_09825468_09827244.mRNA mRNA downstream 68742 9824575 ~ 9827282 (-) True CI01000306_09825468_09827244
CI01000306_09801952_09806496.mRNA mRNA downstream 87224 9801947 ~ 9808800 (-) True CI01000306_09801952_09806496
CI01000306_09753380_09774568.mRNA mRNA downstream 121240 9752368 ~ 9774784 (-) True CI01000306_09753380_09774568
CI01000306_09944940_09958459.mRNA mRNA upstream 48369 9944631 ~ 9959168 (-) True CI01000306_09944940_09958459
CI01000306_09983479_10008765.mRNA mRNA upstream 86331 9982593 ~ 10009753 (-) True CI01000306_09983479_10008765
CI01000306_10025743_10034143.mRNA mRNA upstream 129431 10025693 ~ 10034143 (-) True CI01000306_10025743_10034143
CI01000306_10262423_10269446.mRNA mRNA upstream 366161 10262423 ~ 10269446 (-) True CI01000306_10262423_10269446
CI01000306_10274565_10279388.mRNA mRNA upstream 377603 10273865 ~ 10279388 (-) True CI01000306_10274565_10279388
TU501173 other downstream 59701 9835025 ~ 9836323 (-) True G436626
TU500988 other downstream 224248 9656279 ~ 9671776 (-) True G436446
TU498677 other downstream 3029088 6866656 ~ 6866936 (-) True G434338
TU498395 other downstream 3443773 6437406 ~ 6452251 (-) True G434086
TU498319 other downstream 3534381 6355180 ~ 6361643 (-) True G434016
TU501193 other upstream 125886 10022148 ~ 10025375 (-) True G436643

Expression Profile


TU501222 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU501222 Expression in each Bioproject

Bar chart with 8 bars.
TU501222 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.