RNA id: TU501224



Basic Information


Item Value
RNA id TU501224
length 454
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G436669
representative True

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 9903196 ~ 9903649 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TTTGAACCTTTGACATTTTATGGATTAACTAGGCCACCAAATCAATCATGCTTGTTCAATGTGGCTGCAGTGTGGAATTGTGGGATAACAACATAAACCACCATGAAATGATTATTTTCCTTTGCAACTGCTATTTGTGCCGCTTACGCTCCAACCAAAATGGCATTTTTGTCTATGTATGCACTTCGCAAAAACCAATGTGTCCTCATAAAAAAGGTGCAAAAAATGTTGATGGGGAAATAATACTGAGCCAGATACTCACTCAAACCGCATGGGAGGGAACCGGGGTGATATAGAACAGCAAACATGACAGATATTCACCTAAAAACACATTTGCGATAAGGTCAAGCGTATTATTTCTGAGAATTATCGGAAAGCCGCAACCCGTTCCGATTTCTTTTTCGTTGATATCAAGCAACAAACGTGTTTGTTTGTGAGAAACAGGCTGCAAAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU501222 lncRNA downstream 6934 9896024 ~ 9896262 (-) True G436667
TU501221 lncRNA downstream 7178 9895783 ~ 9896018 (-) True G436666
TU501220 lncRNA downstream 7454 9895518 ~ 9895742 (-) True G436665
TU501219 lncRNA downstream 7913 9895042 ~ 9895283 (-) True G436664
TU501189 lncRNA downstream 9988 9892180 ~ 9893208 (-) True G436639
TU501223 lncRNA upstream 297 9903946 ~ 9904572 (-) True G436668
TU501230 lncRNA upstream 60415 9964064 ~ 9964559 (-) True G436674
TU501236 lncRNA upstream 109786 10013435 ~ 10013659 (-) True G436680
TU501192 lncRNA upstream 174334 10077983 ~ 10109617 (-) True G436642
TU501272 lncRNA upstream 231387 10135036 ~ 10135369 (-) True G436716
CI01000306_09887420_09890429.mRNA mRNA downstream 12767 9887140 ~ 9890429 (-) True CI01000306_09887420_09890429
CI01000306_09879930_09884435.mRNA mRNA downstream 17926 9878694 ~ 9885270 (-) True CI01000306_09879930_09884435
CI01000306_09825468_09827244.mRNA mRNA downstream 75914 9824575 ~ 9827282 (-) True CI01000306_09825468_09827244
CI01000306_09801952_09806496.mRNA mRNA downstream 94396 9801947 ~ 9808800 (-) True CI01000306_09801952_09806496
CI01000306_09753380_09774568.mRNA mRNA downstream 128412 9752368 ~ 9774784 (-) True CI01000306_09753380_09774568
CI01000306_09944940_09958459.mRNA mRNA upstream 40982 9944631 ~ 9959168 (-) True CI01000306_09944940_09958459
CI01000306_09983479_10008765.mRNA mRNA upstream 78944 9982593 ~ 10009753 (-) True CI01000306_09983479_10008765
CI01000306_10025743_10034143.mRNA mRNA upstream 122044 10025693 ~ 10034143 (-) True CI01000306_10025743_10034143
CI01000306_10262423_10269446.mRNA mRNA upstream 358774 10262423 ~ 10269446 (-) True CI01000306_10262423_10269446
CI01000306_10274565_10279388.mRNA mRNA upstream 370216 10273865 ~ 10279388 (-) True CI01000306_10274565_10279388
TU501173 other downstream 66873 9835025 ~ 9836323 (-) True G436626
TU500988 other downstream 231420 9656279 ~ 9671776 (-) True G436446
TU498677 other downstream 3036260 6866656 ~ 6866936 (-) True G434338
TU498395 other downstream 3450945 6437406 ~ 6452251 (-) True G434086
TU498319 other downstream 3541553 6355180 ~ 6361643 (-) True G434016
TU501193 other upstream 118499 10022148 ~ 10025375 (-) True G436643

Expression Profile


TU501224 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.3.
End of interactive chart.

TU501224 Expression in each Bioproject

Bar chart with 19 bars.
TU501224 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.