RNA id: TCONS_00021958


Basic Information

Item Value
RNA id TCONS_00021958
length 791
lncRNA type inter_gene
GC content 0.51
exon number 4
gene id XLOC_010005
representative False

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 29211362 ~ 29230847 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCGGAATGATAAGAGGGGGGACAACGAGCAGCTCATTTCACTCTCCGTAGGGGAGGAGAGGAGCATCTCAATGGGAAATATGGGTGAAAAGACTGCGTGCAGCCCGATACGGAGAAGCTGAATGGATGGGGCCACTGCAACGTCACGCGGAGCCGCAGCCATGAAGCGGAGGACCAAAGCGCAAGACAACATTCTGGAGTGCACGCAGCTCGCACGCGCATATTTATCATTACGATCGGTCCTGAATACCATCGATGCTCGAGGATAGGAGTTGCAGTTCAGCCCTGGTTGGATGGAAATGGACGGGTGGCCGGAGGGGTTGGCTGTTATCTTTGGTTATCTAGCTGTATGAGTGTTATTCATTCTTCATAAAGCTAGATAACCGAAAGTAACAAGAATCCCATTACACACCTGAAAGGCATCACCCCACCTTGAGATCTGTACTCCTCCCCTCTCCTCTTCTCCTCTTTTCCCTCCCAAGTCTCCCTCTCTCTCAGTTTCAATCTCTGCATCATTTTATTGTGAGAGCAAGCCACAAAATGGCCTCCATCAGTGCTGATATGGAAGAGACCAACCACCTTTGATGCCAAGGAAAGGAATGGGCGAAGAAGCATGGCAGGTTATAATGTGGTTGTTGTCCTACTGGCATTGCTGCTCCCCTCCCCTTCATCGCTCGCCTGCCCCCTTCCTCTCGTCACGAGATGCAGTTTGCACAAAGCCACCATCTTAGAGCATGCGGGCATTACATGGAAGTGGAAAATAAGCAGGCACCAGCCTTGGGAACCACCACG

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0021536 diencephalon development biological_process
GO:0048468 cell development biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0030154 cell differentiation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0030182 neuron differentiation biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0048869 cellular developmental process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0050767 regulation of neurogenesis biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0030900 forebrain development biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0022008 neurogenesis biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0048699 generation of neurons biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00019908 lncRNA upstream 183443 29025301 ~ 29029007 (+) False XLOC_010003
TCONS_00019909 lncRNA upstream 186568 29025303 ~ 29025882 (+) True XLOC_010003
TCONS_00021954 lncRNA upstream 545117 28660395 ~ 28667333 (+) False XLOC_009994
TCONS_00021955 lncRNA upstream 548590 28660403 ~ 28663860 (+) True XLOC_009994
TCONS_00021953 lncRNA upstream 941055 28270015 ~ 28271395 (+) False XLOC_009987
TCONS_00021962 lncRNA downstream 22022 29245880 ~ 29250848 (+) True XLOC_010006
TCONS_00019920 lncRNA downstream 285280 29509138 ~ 29512405 (+) True XLOC_010010
TCONS_00019922 lncRNA downstream 290638 29514496 ~ 29517538 (+) False XLOC_010011
TCONS_00021963 lncRNA downstream 367261 29591119 ~ 29600668 (+) True XLOC_010014
TCONS_00021721 lncRNA downstream 497769 29721627 ~ 29730138 (+) False XLOC_010018
TCONS_00019910 mRNA upstream 154601 29043813 ~ 29057849 (+) True XLOC_010004
TCONS_00019907 mRNA upstream 181776 29025292 ~ 29030674 (+) False XLOC_010003
TCONS_00019906 mRNA upstream 183167 29025292 ~ 29029283 (+) False XLOC_010003
TCONS_00019904 mRNA upstream 187681 28994709 ~ 29024769 (+) False XLOC_010002
TCONS_00019903 mRNA upstream 221074 28932038 ~ 28991376 (+) True XLOC_010001
TCONS_00019913 mRNA downstream 80113 29303971 ~ 29308947 (+) True XLOC_010007
TCONS_00019914 mRNA downstream 152893 29376751 ~ 29384935 (+) False XLOC_010008
TCONS_00019915 mRNA downstream 152936 29376794 ~ 29384930 (+) False XLOC_010008
TCONS_00019916 mRNA downstream 152952 29376810 ~ 29384505 (+) True XLOC_010008
TCONS_00019917 mRNA downstream 268891 29492749 ~ 29502787 (+) False XLOC_010009
TCONS_00019905 other upstream 193312 29016936 ~ 29019138 (+) True XLOC_010002
TCONS_00019885 other upstream 824287 28388046 ~ 28388163 (+) True XLOC_009989
TCONS_00019873 other upstream 1657210 27549842 ~ 27555240 (+) False XLOC_009979
TCONS_00019869 other upstream 1657348 27543582 ~ 27555102 (+) False XLOC_009979
TCONS_00019938 other downstream 778894 30002752 ~ 30036693 (+) False XLOC_010020
TCONS_00019939 other downstream 856685 30080543 ~ 30080661 (+) True XLOC_010021
TCONS_00019951 other downstream 1746643 30970501 ~ 30971157 (+) True XLOC_010029
TCONS_00019955 other downstream 2410612 31634470 ~ 31634595 (+) True XLOC_010035
TCONS_00019961 other downstream 2605180 31829038 ~ 31836487 (+) True XLOC_010037

Expression Profile

//