RNA id: TCONS_00021964


Basic Information

Item Value
RNA id TCONS_00021964
length 360
lncRNA type sense_over
GC content 0.46
exon number 3
gene id XLOC_010020
representative False

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 30002605 ~ 30271444 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CACAATGTAATAGAGTTTTAGCGCAGTCTTGCTTTTTCAAAGGCGTGTGTCAACTCTGTGTGCCAAGGGCTGCTCCGCTTTTACCAATGCGATTAATGAAGACAACGAACCAATTGAGGGAACACTAAACTAATAACCTTCCGTTTCGTTTCGTCTGTTGTTTTTAATACGGACGAGCTTCGTCTCTGCAAGGAATCAACCCTCTGCACGAGCACAAAGGAAAATTTAAAAGGCAAGCAAAGGTCGGTTGTGGAATGTCACAGCTTTCTCAAACATCCAGACCTTTATCCTTGCTCGTCTGCAGTCCTGCTGTCTGATTGGATCATCCTTCAAGGCCCTGCAGCTGTGCACCGAGCTCAG

Function

GO:

id name namespace
GO:0001755 neural crest cell migration biological_process
GO:0050919 negative chemotaxis biological_process
GO:0048843 negative regulation of axon extension involved in axon guidance biological_process
GO:0007411 axon guidance biological_process
GO:0030335 positive regulation of cell migration biological_process
GO:0071526 semaphorin-plexin signaling pathway biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0005615 extracellular space cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0045499 chemorepellent activity molecular_function
GO:0030215 semaphorin receptor binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00019936 lncRNA upstream 93782 29903644 ~ 29908970 (+) True XLOC_010019
TCONS_00021723 lncRNA upstream 189500 29721663 ~ 29813252 (+) False XLOC_010018
TCONS_00021722 lncRNA upstream 193855 29721663 ~ 29808897 (+) False XLOC_010018
TCONS_00021724 lncRNA upstream 264324 29729983 ~ 29738428 (+) True XLOC_010018
TCONS_00021721 lncRNA upstream 272614 29721627 ~ 29730138 (+) False XLOC_010018
TCONS_00021966 lncRNA downstream 290139 30329863 ~ 30330881 (+) False XLOC_010024
TCONS_00021967 lncRNA downstream 290556 30330280 ~ 30330881 (+) True XLOC_010024
TCONS_00021968 lncRNA downstream 1051274 31090998 ~ 31094580 (+) True XLOC_010030
TCONS_00021725 lncRNA downstream 1082032 31121756 ~ 31128084 (+) False XLOC_010031
TCONS_00021726 lncRNA downstream 1082032 31121756 ~ 31135431 (+) True XLOC_010031
TCONS_00019935 mRNA upstream 305963 29690708 ~ 29696789 (+) True XLOC_010017
TCONS_00019934 mRNA upstream 317894 29663809 ~ 29684858 (+) True XLOC_010016
TCONS_00019933 mRNA upstream 318559 29650698 ~ 29684193 (+) False XLOC_010016
TCONS_00019929 mRNA upstream 355014 29630965 ~ 29647738 (+) False XLOC_010015
TCONS_00019940 mRNA downstream 78074 30117798 ~ 30245831 (+) False XLOC_010020
TCONS_00019941 mRNA downstream 78147 30117871 ~ 30267666 (+) True XLOC_010020
TCONS_00019942 mRNA downstream 261815 30301539 ~ 30306358 (+) True XLOC_010022
TCONS_00019943 mRNA downstream 276453 30316177 ~ 30326055 (+) True XLOC_010023
TCONS_00019944 mRNA downstream 398317 30438041 ~ 30519254 (+) False XLOC_010025
TCONS_00019912 other upstream 786392 29216274 ~ 29216360 (+) True XLOC_010005
TCONS_00019905 other upstream 983614 29016936 ~ 29019138 (+) True XLOC_010002
TCONS_00019885 other upstream 1614589 28388046 ~ 28388163 (+) True XLOC_009989
TCONS_00019873 other upstream 2447512 27549842 ~ 27555240 (+) False XLOC_009979
TCONS_00019870 other upstream 2452396 27543588 ~ 27550356 (+) False XLOC_009979
TCONS_00019939 other downstream 40819 30080543 ~ 30080661 (+) True XLOC_010021
TCONS_00019951 other downstream 930777 30970501 ~ 30971157 (+) True XLOC_010029
TCONS_00019955 other downstream 1594746 31634470 ~ 31634595 (+) True XLOC_010035
TCONS_00019961 other downstream 1789314 31829038 ~ 31836487 (+) True XLOC_010037
TCONS_00019968 other downstream 1883063 31922787 ~ 31923924 (+) True XLOC_010039

Expression Profile

//