RNA id: TCONS_00020194


Basic Information

Item Value
RNA id TCONS_00020194
length 732
RNA type nonsense_mediated_decay
GC content 0.41
exon number 7
gene id XLOC_010194
representative False

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 42772668 ~ 42781775 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATCAGTAATGATTCAGTTCCTCCAGATTAGGTGCTATTTCTACTTCTAAATGGATTTTAATTGTAACACTGAATTATTGTTACCCAAGCACATTTAAGGATGCCCAGACATGATGATATGAACAGCTATCTCCAACAACAAACCTCACCATTTGACCAACAGGTGCTTTCTAAATTCCTGAACATCAGCCCAAAGGCTTTGGGGGCTTTGGAAATATCAGTAGGTATAGAAATGCTTGTTCTATCAATCTGGACAAGGTTTTTGTATCTTCTCTGGCCGTGTCTAATTTCAATTTTAACTGGATCTGTGACTATCTCAGCTGCACACATTCGTAGCACATGTCAGTGCCATAGCAGCCGTTGTCTCCATTCCATGTCACTGTTTGGACAGTGAGGGTAAGACTCTAATTCTCTTGCTAGTCTGTGATGTTCTGATCTTCATCCTCTCTGTTATTGTGGCCTCTACATTTTGTGACTGCTGCAAGAAGTCTGGGCGAGCTGCAGTGAGTTACATAAAAAGAGATGTGCCTTACATGACTGATAACAATACTGAGCCTCAGGGACAACAAAACCCCTTTATACCTCCACCATACAGTGATCAAGGCAGTTCTGCACTTCAATCAAACTACAATCCAAAACTTTCTGCACCTCTGCCAAAATATGATCTATATCCTTCTCTGGCAAACTACATCCCAAATAATGATGCAGTCTTGTCTTCACCTTCGTTTAATTA

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0000027 ribosomal large subunit assembly biological_process
GO:0000028 ribosomal small subunit assembly biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0043009 chordate embryonic development biological_process
GO:0019538 protein metabolic process biological_process
GO:0043603 cellular amide metabolic process biological_process
GO:0043604 amide biosynthetic process biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:1901566 organonitrogen compound biosynthetic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0007275 multicellular organism development biological_process
GO:0006412 translation biological_process
GO:0043933 protein-containing complex subunit organization biological_process
GO:0048856 anatomical structure development biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0044238 primary metabolic process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0042255 ribosome assembly biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044267 cellular protein metabolic process biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0032501 multicellular organismal process biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0032502 developmental process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0009790 embryo development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0044391 ribosomal subunit cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0022625 cytosolic large ribosomal subunit cellular_component
GO:0022626 cytosolic ribosome cellular_component
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0044444 obsolete cytoplasmic part cellular_component
GO:0044445 obsolete cytosolic part cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0005829 cytosol cellular_component
GO:0005840 ribosome cellular_component
GO:0005854 nascent polypeptide-associated complex cellular_component
GO:0032991 protein-containing complex cellular_component
GO:0015934 large ribosomal subunit cellular_component
GO:0015935 small ribosomal subunit cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0043226 organelle cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0019843 rRNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0005198 structural molecule activity molecular_function
GO:0003723 RNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
ko00230 Purine metabolism
ko00240 Pyrimidine metabolism
ko03020 RNA polymerase
ko03230 Viral genome structure
ko05164 Influenza A
ko05169 Epstein-Barr virus infection
ko05016 Huntington disease
ko03200 Viral proteins

ZFIN:

id description
ZDB-GENE-131121-526 Predicted to be located in membrane. Predicted to be integral component of membrane.

Ensembl:

ensembl_id ENSDART00000157147

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00022015 lncRNA upstream 79049 42691059 ~ 42693663 (+) True XLOC_010193
TCONS_00022014 lncRNA upstream 250776 42520706 ~ 42521936 (+) True XLOC_010191
TCONS_00020184 lncRNA upstream 302566 42464009 ~ 42470146 (+) False XLOC_010187
TCONS_00022013 lncRNA upstream 302566 42464222 ~ 42470146 (+) False XLOC_010187
TCONS_00021748 lncRNA upstream 435163 42337245 ~ 42337549 (+) True XLOC_010186
TCONS_00022016 lncRNA downstream 14210 42795604 ~ 42800731 (+) True XLOC_010195
TCONS_00020199 lncRNA downstream 116188 42897582 ~ 42901740 (+) False XLOC_010198
TCONS_00022017 lncRNA downstream 116236 42897630 ~ 42901740 (+) False XLOC_010198
TCONS_00020201 lncRNA downstream 117081 42898475 ~ 42900680 (+) True XLOC_010198
TCONS_00022019 lncRNA downstream 260111 43041505 ~ 43048279 (+) False XLOC_010199
TCONS_00020191 mRNA upstream 89211 42667560 ~ 42683501 (+) True XLOC_010192
TCONS_00020190 mRNA upstream 277329 42482270 ~ 42495383 (+) True XLOC_010190
TCONS_00020189 mRNA upstream 278367 42481447 ~ 42494345 (+) False XLOC_010190
TCONS_00020188 mRNA upstream 294760 42477155 ~ 42477952 (+) True XLOC_010189
TCONS_00020187 mRNA upstream 299725 42471455 ~ 42472987 (+) True XLOC_010188
TCONS_00020196 mRNA downstream 48341 42829735 ~ 42843397 (+) False XLOC_010196
TCONS_00020197 mRNA downstream 48758 42830152 ~ 42842970 (+) True XLOC_010196
TCONS_00020202 mRNA downstream 296515 43077909 ~ 43118095 (+) True XLOC_010200
TCONS_00020203 mRNA downstream 358110 43139504 ~ 43150489 (+) True XLOC_010202
TCONS_00020204 mRNA downstream 371333 43152727 ~ 43284939 (+) False XLOC_010203
TCONS_00020166 other upstream 1224275 41546763 ~ 41548437 (+) True XLOC_010175
TCONS_00020157 other upstream 1718480 41042310 ~ 41054232 (+) False XLOC_010166
TCONS_00020150 other upstream 2186936 40576679 ~ 40585776 (+) False XLOC_010161
TCONS_00020144 other upstream 2423758 40346595 ~ 40348954 (+) True XLOC_010157
TCONS_00020142 other upstream 2425336 40346447 ~ 40347376 (+) False XLOC_010157
TCONS_00020198 other downstream 95052 42876446 ~ 42878011 (+) True XLOC_010197
TCONS_00020200 other downstream 117035 42898429 ~ 42898510 (+) False XLOC_010198
TCONS_00020214 other downstream 1823932 44605326 ~ 44605440 (+) True XLOC_010211
TCONS_00020216 other downstream 1901671 44683065 ~ 44687935 (+) True XLOC_010212
TCONS_00020217 other downstream 1922978 44704372 ~ 44705154 (+) True XLOC_010213

Expression Profile

//