RNA id: TCONS_00001595


Basic Information

Item Value
RNA id TCONS_00001595
length 769
RNA type processed_transcript
GC content 0.53
exon number 4
gene id XLOC_001004
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 8649099 ~ 8653385 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCTCAGCATTGTGAGTTTTCAGTGCACGCTGAGAAGATCTTCACTCCCCTTGTTCACAATAACCTACTAATACACAGCCATGGATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTCCGGTATGTGCAAAGCCGGTTTTGCTGGAGATGATGCCCCTCGTGCTGTTTTCCCCTCCATTGTTGGACGACCCAGACATCAGGTACATTTAATAAACCATCCTAATAACATATCTGGCATCACACCTTCTACAATGAGCTCCGTGTTGCCCCTGAGGAGCACCCTGTGCTGCTCACTGAGGCTCCCCTGAATCCCAAAGCCAACAGAGAGAAGATGACACAGATCATGTTCGAGACCTTCAACACCCCTGCCATGTATGTGGCCATCCAGGCTGTGCTCTCTCTGTACGCTTCTGGTCGTACTACTGGTATTGTGATGGACTCTGGTGATGGTGTGACCCACACCGTGCCCATCTATGAGGGTTACGCTCTTCCCCATGCCATCCTGCGTCTGGATCTGGCTGGTCGTGACCTGACAGACTACCTGATGAAGATCCTGACCGAGCGTGGCTACAGCTTCACCACCACGGCCGAAAGAGAAATTGTCCGTGACATCAAGGAGAAGCTGTGCTACGTGGCCCTGGACTTTGAGCAGGAGATGGGAACCGCTGCCTCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCTGACGGTCAGGTCATCACCATTGGCAATGAGCGTTTCCGTTGCCCCGAGGCTCTCTTCCAGC

Function

GO:

id name namespace
GO:0005856 cytoskeleton cellular_component
GO:0005884 actin filament cellular_component
GO:0005886 plasma membrane cellular_component
GO:0015629 actin cytoskeleton cellular_component
GO:0097433 dense body cellular_component
GO:0005925 focal adhesion cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0098973 structural constituent of postsynaptic actin cytoskeleton molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-000329-1 Predicted to be a structural constituent of postsynaptic actin cytoskeleton. Predicted to be located in several cellular components, including actin cytoskeleton; dense body; and focal adhesion. Predicted to be active in actin filament. Is expressed in several structures, including eye; hematopoietic cell; liver; male organism; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in Baraitser-Winter syndrome and autosomal dominant nonsyndromic deafness 20. Orthologous to several human genes including ACTB (actin beta).

Ensembl:

ensembl_id ENSDART00000148067

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00001590 lncRNA downstream 24843 8615853 ~ 8625266 (-) False XLOC_001002
TCONS_00002917 lncRNA downstream 25167 8612575 ~ 8624942 (-) False XLOC_001002
TCONS_00003335 lncRNA downstream 25227 8622702 ~ 8624882 (-) True XLOC_001002
TCONS_00001589 lncRNA downstream 31465 8615535 ~ 8618644 (-) False XLOC_001002
TCONS_00003334 lncRNA downstream 62750 8579155 ~ 8587359 (-) True XLOC_001001
TCONS_00003336 lncRNA upstream 321845 8974500 ~ 8977960 (-) False XLOC_001008
TCONS_00001604 lncRNA upstream 321845 8974500 ~ 8977963 (-) True XLOC_001008
TCONS_00003337 lncRNA upstream 326250 8978905 ~ 8980671 (-) False XLOC_001009
TCONS_00003338 lncRNA upstream 429187 9081842 ~ 9082772 (-) True XLOC_001010
TCONS_00003339 lncRNA upstream 485983 9138638 ~ 9139160 (-) True XLOC_001015
TCONS_00001591 mRNA downstream 3168 8638162 ~ 8646941 (-) True XLOC_001003
TCONS_00001588 mRNA downstream 83542 8555323 ~ 8566567 (-) True XLOC_001000
TCONS_00001582 mRNA downstream 96814 8539671 ~ 8553295 (-) False XLOC_000999
TCONS_00001585 mRNA downstream 96944 8549849 ~ 8553165 (-) False XLOC_000999
TCONS_00001579 mRNA downstream 221348 8415983 ~ 8428761 (-) False XLOC_000997
TCONS_00001599 mRNA upstream 20406 8673061 ~ 8691969 (-) True XLOC_001005
TCONS_00001600 mRNA upstream 110774 8763429 ~ 8928841 (-) False XLOC_001006
TCONS_00001601 mRNA upstream 112969 8765624 ~ 8917902 (-) True XLOC_001006
TCONS_00001602 mRNA upstream 309969 8962624 ~ 8966046 (-) False XLOC_001007
TCONS_00001603 mRNA upstream 310198 8962853 ~ 8963484 (-) True XLOC_001007
TCONS_00001587 other downstream 96811 8552750 ~ 8553298 (-) True XLOC_000999
TCONS_00001570 other downstream 674340 7970406 ~ 7975769 (-) True XLOC_000989
TCONS_00001564 other downstream 729903 7920119 ~ 7920206 (-) True XLOC_000985
TCONS_00001563 other downstream 730542 7919480 ~ 7919567 (-) True XLOC_000984
TCONS_00001562 other downstream 731227 7918795 ~ 7918882 (-) False XLOC_000984
TCONS_00001610 other upstream 465445 9118100 ~ 9118671 (-) False XLOC_001012
TCONS_00001617 other upstream 545204 9197859 ~ 9197966 (-) True XLOC_001018
TCONS_00001629 other upstream 807355 9460010 ~ 9486080 (-) False XLOC_001025
TCONS_00001646 other upstream 1088147 9740802 ~ 9816875 (-) True XLOC_001029
TCONS_00001656 other upstream 1410846 10063501 ~ 10064568 (-) False XLOC_001036

Expression Profile

//