RNA id: TCONS_00001620


Basic Information

Item Value
RNA id TCONS_00001620
length 284
RNA type mRNA
GC content 0.45
exon number 2
gene id XLOC_001019
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 9227081 ~ 9228007 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAGAATAAAATGACGGCTGGTGATTTAGATGGATGAGCTGGATGAAGATCAGCTGAAGAATCATGTGGAAAGCCTGAAGCAACAGCTCAAGTATAACAGAGTCAACACATCCGTCTCTGTTCCAGAGTTAATTAAATGGATGGAGGAGAAAATGACCGAGGATCCATTTGTGAATCCAGATGCCATGAAGGACAACCCGTGGGTGGAGTCGAGCAAATGTGTAATACTCTAGCACAAGAGCTGTCAATCATCCCTATGGCAGCAGAAGTGGCTCCGCCCTCTTA

Function

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0007200 phospholipase C-activating G protein-coupled receptor signaling pathway biological_process
GO:0050909 sensory perception of taste biological_process
GO:0007165 signal transduction biological_process
GO:0005834 heterotrimeric G-protein complex cellular_component
GO:0003924 GTPase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-081022-188 Predicted to enable G-protein beta-subunit binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to act upstream of or within phospholipase C-activating G protein-coupled receptor signaling pathway and sensory perception of taste. Predicted to be part of heterotrimeric G-protein complex. Orthologous to human GNG13 (G protein subunit gamma 13).

Ensembl:

ensembl_id ENSDART00000190360

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00001614 lncRNA downstream 64603 9157310 ~ 9162637 (-) True XLOC_001016
TCONS_00003339 lncRNA downstream 88080 9138638 ~ 9139160 (-) True XLOC_001015
TCONS_00003338 lncRNA downstream 144468 9081842 ~ 9082772 (-) True XLOC_001010
TCONS_00003337 lncRNA downstream 246569 8978905 ~ 8980671 (-) False XLOC_001009
TCONS_00001604 lncRNA downstream 249277 8974500 ~ 8977963 (-) True XLOC_001008
TCONS_00001626 lncRNA upstream 80467 9308271 ~ 9314795 (-) False XLOC_001023
TCONS_00001627 lncRNA upstream 86704 9314508 ~ 9321931 (-) True XLOC_001023
TCONS_00003340 lncRNA upstream 193020 9420824 ~ 9422275 (-) True XLOC_001024
TCONS_00003341 lncRNA upstream 688572 9916376 ~ 9918812 (-) True XLOC_001031
TCONS_00001651 lncRNA upstream 744892 9972696 ~ 9980810 (-) False XLOC_001033
TCONS_00001616 mRNA downstream 31480 9169807 ~ 9195760 (-) True XLOC_001017
TCONS_00001615 mRNA downstream 31611 9169807 ~ 9195629 (-) False XLOC_001017
TCONS_00001613 mRNA downstream 93195 9132335 ~ 9134045 (-) True XLOC_001014
TCONS_00001612 mRNA downstream 97104 9125023 ~ 9130136 (-) True XLOC_001013
TCONS_00001611 mRNA downstream 103775 9118100 ~ 9123465 (-) True XLOC_001012
TCONS_00001621 mRNA upstream 2440 9230244 ~ 9231952 (-) True XLOC_001020
TCONS_00001622 mRNA upstream 7124 9234928 ~ 9249943 (-) True XLOC_001021
TCONS_00001623 mRNA upstream 31127 9258931 ~ 9277986 (-) False XLOC_001022
TCONS_00001624 mRNA upstream 42211 9270015 ~ 9277986 (-) False XLOC_001022
TCONS_00001625 mRNA upstream 45404 9273208 ~ 9278037 (-) True XLOC_001022
TCONS_00001617 other downstream 29274 9197859 ~ 9197966 (-) True XLOC_001018
TCONS_00001610 other downstream 108569 9118100 ~ 9118671 (-) False XLOC_001012
TCONS_00001595 other downstream 574585 8650109 ~ 8652655 (-) False XLOC_001004
TCONS_00001587 other downstream 673942 8552750 ~ 8553298 (-) True XLOC_000999
TCONS_00001570 other downstream 1251471 7970406 ~ 7975769 (-) True XLOC_000989
TCONS_00001629 other upstream 232206 9460010 ~ 9486080 (-) False XLOC_001025
TCONS_00001646 other upstream 512998 9740802 ~ 9816875 (-) True XLOC_001029
TCONS_00001656 other upstream 835697 10063501 ~ 10064568 (-) False XLOC_001036
TCONS_00001657 other upstream 836070 10063874 ~ 10068533 (-) False XLOC_001036
TCONS_00001660 other upstream 838427 10066231 ~ 10071422 (-) False XLOC_001036

Expression Profile

//