RNA id: TCONS_00022080



Basic Information


Item Value
RNA id TCONS_00022080
length 621
lncRNA type inter_gene
GC content 0.44
exon number 3
gene id XLOC_010391
representative True

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 4234727 ~ 4267736 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


TCTCCCTTCCGTAACCAGCCAATGAGACGTCAGAGATGCTCGGTGTGGTCAAGTGACTGCTGACTTCATGGAGTCTGAGAAGGTGACCTTGCCCTCATTGTCTATAAACATCAACTGGAGGTCAGCCAGCAGTCAGACCACACCGACGAGCATTTCCAGCACCGCTGCCCGAGTCCTGGAGGATCTGCTGTGTCCATCTGCCTTCAGCGCTCAATATTTACCCAAGGTGACTCTTGTATACAAGGAGATTCCTGTATATGATCCAGCGTCCGTGACATCTGAACGTATCATGGCAGCTCATGCTACTTTTAGCATATCGAGCCTCATGACTGGACTCGCTTGTCATGGAATTTATCCAGAATATTCTTGCAGAGACTTTCACAAAGCCTCATGTAAACACCCTCCACTGAAGCTTTGATCAACATATACTCAACAGAGCTTGTCTCTTGAATTTCTCTAATGCCTGATAAAAGTTTACGAGATGATTAGATGATTGTTGTTAGTATACTCTGGGATGAACTACATGTGTTATCGCTCATGGCAAATAAAGTGCACATTAAATGCAGAACAGAACATCACTAAAACTGCACTTTTATTGAGAATAAATTCAAATGTGATGTG

Function


GO:

id name namespace
GO:0030388 fructose 1,6-bisphosphate metabolic process biological_process
GO:0030672 synaptic vesicle membrane cellular_component
GO:0044421 obsolete extracellular region part cellular_component
GO:0031012 extracellular matrix cellular_component
GO:0062023 collagen-containing extracellular matrix cellular_component
GO:0005576 extracellular region cellular_component
GO:0099501 exocytic vesicle membrane cellular_component
GO:0019838 growth factor binding molecular_function
GO:0005201 extracellular matrix structural constituent molecular_function

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00022079 lncRNA downstream 55350 4179036 ~ 4179967 (-) True XLOC_010388
TCONS_00022078 lncRNA downstream 55403 4179036 ~ 4179914 (-) False XLOC_010388
TCONS_00022077 lncRNA downstream 55403 4179036 ~ 4179914 (-) False XLOC_010388
TCONS_00022076 lncRNA downstream 438684 3784874 ~ 3796633 (-) True XLOC_010386
TCONS_00021779 lncRNA downstream 886608 3348006 ~ 3348709 (-) True XLOC_010384
TCONS_00022081 lncRNA upstream 286335 4554071 ~ 4558497 (-) True XLOC_010396
TCONS_00020448 lncRNA upstream 417927 4685663 ~ 4695623 (-) True XLOC_010399
TCONS_00020463 lncRNA upstream 877396 5145132 ~ 5146268 (-) False XLOC_010407
TCONS_00020466 lncRNA upstream 878126 5145862 ~ 5153973 (-) True XLOC_010407
TCONS_00022082 lncRNA upstream 902039 5169775 ~ 5172164 (-) False XLOC_010408
TCONS_00020432 mRNA downstream 32295 4196932 ~ 4203022 (-) True XLOC_010389
TCONS_00020430 mRNA downstream 203931 4010967 ~ 4031386 (-) False XLOC_010387
TCONS_00020431 mRNA downstream 209052 4011282 ~ 4026265 (-) True XLOC_010387
TCONS_00020429 mRNA downstream 556341 3463727 ~ 3678976 (-) True XLOC_010385
TCONS_00020428 mRNA downstream 1107568 3103182 ~ 3127749 (-) True XLOC_010383
TCONS_00020436 mRNA upstream 19806 4287542 ~ 4317879 (-) True XLOC_010392
TCONS_00020437 mRNA upstream 245861 4513597 ~ 4531657 (-) True XLOC_010393
TCONS_00020439 mRNA upstream 273245 4540981 ~ 4546965 (-) False XLOC_010395
TCONS_00020440 mRNA upstream 274707 4542443 ~ 4547193 (-) True XLOC_010395
TCONS_00020441 mRNA upstream 302681 4570417 ~ 4610255 (-) False XLOC_010397
TCONS_00020433 other downstream 23382 4210477 ~ 4211935 (-) True XLOC_010390
TCONS_00020424 other downstream 1499518 2735676 ~ 2735799 (-) True XLOC_010378
TCONS_00020422 other downstream 1593823 2638359 ~ 2641494 (-) False XLOC_010377
TCONS_00020438 other upstream 259745 4527481 ~ 4527647 (-) True XLOC_010394
TCONS_00020445 other upstream 347925 4615661 ~ 4619765 (-) False XLOC_010398
TCONS_00020450 other upstream 444928 4712664 ~ 4719385 (-) True XLOC_010400
TCONS_00020457 other upstream 793763 5061499 ~ 5061629 (-) True XLOC_010404
TCONS_00020459 other upstream 839562 5107298 ~ 5107417 (-) True XLOC_010405

Expression Profile


Expression of TCONS_00022080 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.
//

Expression of TCONS_00022080 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.