RNA id: TCONS_00020458


Basic Information

Item Value
RNA id TCONS_00020458
length 209
RNA type mRNA
GC content 0.61
exon number 1
gene id XLOC_010403
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 5013868 ~ 5105322 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACGGGTTCCAGCGCAATGGCGGCGACGCGGCTCTTCTTAAGAAGTTCGTGTGTGAAGTCTCGTTTAACGGGGTTCACTGGCGGAGTGCACGGTAGTTTGAGCTTAACACTGCTCAAACGGTCGCCGGACTGCACAGCCCAGCCGCGGGCGCAGAGGAGACATGCAGCGCACTTCACATACCAGCCCGACCCGGTGCCCACTCAGTACGG

Function

GO:

id name namespace
GO:0009083 branched-chain amino acid catabolic process biological_process
GO:0007584 response to nutrient biological_process
GO:0005947 mitochondrial alpha-ketoglutarate dehydrogenase complex cellular_component
GO:0005739 mitochondrion cellular_component
GO:0003824 catalytic activity molecular_function
GO:0003826 alpha-ketoacid dehydrogenase activity molecular_function

KEGG:

id description
ko00640 Propanoate metabolism
ko00280 Valine, leucine and isoleucine degradation

ZFIN:

id description
ZDB-GENE-030124-2 Predicted to enable catalytic activity. Predicted to be involved in branched-chain amino acid catabolic process and response to nutrient. Predicted to be part of mitochondrial alpha-ketoglutarate dehydrogenase complex. Human ortholog(s) of this gene implicated in maple syrup urine disease. Orthologous to human BCKDHB (branched chain keto acid dehydrogenase E1 subunit beta).

Ensembl:

ensembl_id ENSDART00000148955

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00020448 lncRNA downstream 409464 4685663 ~ 4695623 (-) True XLOC_010399
TCONS_00022081 lncRNA downstream 546590 4554071 ~ 4558497 (-) True XLOC_010396
TCONS_00022080 lncRNA downstream 837351 4235317 ~ 4267736 (-) True XLOC_010391
TCONS_00020435 lncRNA downstream 863102 4234727 ~ 4241985 (-) False XLOC_010391
TCONS_00020434 lncRNA downstream 866726 4234727 ~ 4238361 (-) False XLOC_010391
TCONS_00020463 lncRNA upstream 39837 5145132 ~ 5146268 (-) False XLOC_010407
TCONS_00020466 lncRNA upstream 40567 5145862 ~ 5153973 (-) True XLOC_010407
TCONS_00022082 lncRNA upstream 64480 5169775 ~ 5172164 (-) False XLOC_010408
TCONS_00022083 lncRNA upstream 64480 5169775 ~ 5173443 (-) True XLOC_010408
TCONS_00022084 lncRNA upstream 347885 5453180 ~ 5588566 (-) False XLOC_010409
TCONS_00020454 mRNA downstream 268869 4834527 ~ 4836218 (-) True XLOC_010402
TCONS_00020452 mRNA downstream 334854 4746589 ~ 4770233 (-) False XLOC_010401
TCONS_00020451 mRNA downstream 335120 4746588 ~ 4769967 (-) False XLOC_010401
TCONS_00020453 mRNA downstream 335210 4746788 ~ 4769877 (-) True XLOC_010401
TCONS_00020449 mRNA downstream 383458 4710977 ~ 4721629 (-) False XLOC_010400
TCONS_00020460 mRNA upstream 5160 5110455 ~ 5115993 (-) False XLOC_010406
TCONS_00020461 mRNA upstream 5164 5110459 ~ 5143176 (-) False XLOC_010406
TCONS_00020462 mRNA upstream 5256 5110551 ~ 5143124 (-) True XLOC_010406
TCONS_00020464 mRNA upstream 39837 5145132 ~ 5154032 (-) False XLOC_010407
TCONS_00020465 mRNA upstream 40285 5145580 ~ 5154024 (-) False XLOC_010407
TCONS_00020457 other downstream 43458 5061499 ~ 5061629 (-) True XLOC_010404
TCONS_00020450 other downstream 385702 4712664 ~ 4719385 (-) True XLOC_010400
TCONS_00020445 other downstream 485322 4615661 ~ 4619765 (-) False XLOC_010398
TCONS_00020438 other downstream 577440 4527481 ~ 4527647 (-) True XLOC_010394
TCONS_00020433 other downstream 893152 4210477 ~ 4211935 (-) True XLOC_010390
TCONS_00020459 other upstream 2003 5107298 ~ 5107417 (-) True XLOC_010405
TCONS_00020472 other upstream 716002 5821297 ~ 5857981 (-) True XLOC_010415
TCONS_00020473 other upstream 765278 5870573 ~ 5870689 (-) True XLOC_010416
TCONS_00020493 other upstream 1723257 6828552 ~ 6829635 (-) True XLOC_010430
TCONS_00020500 other upstream 2114697 7219992 ~ 7228279 (-) True XLOC_010432

Expression Profile

//