RNA id: TCONS_00020559


Basic Information

Item Value
RNA id TCONS_00020559
length 355
RNA type TEC
GC content 0.45
exon number 3
gene id XLOC_010469
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 10097122 ~ 10261652 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCCATCGTGATGGCTTCACTTCAAGTTAACTTGAGTGTTGATTTTAAGTGCAACATGTCTTTGTATTGATTGGGGTTTCGGCGCTATGTTTGTGTGAATTGGATTATCGAAATACGCTCAAAGAGGTGGTGAAGTCCCCGTGTCAGTGAGTATCAAAGATATGGAGAACACCCAAAACATTGAGGAGGAGCCTTTTCCTAGCTTTCTTTCAAATGCTTCGCTTGGGATGCCCAAGGCCGCCTCCACCGTGGCTAAAATTAGACCGTCAATAGACAACAGAGTAACTGATGTCCAAGCATCATATCTGGAGGAAGCACAGTCACGCATGCATTCTCAGGGATCTGATGGAAGCAAG

Function

GO:

id name namespace
GO:0071539 protein localization to centrosome biological_process
GO:0051298 centrosome duplication biological_process
GO:0090222 centrosome-templated microtubule nucleation biological_process

KEGG:

id description
ko01009 Protein phosphatases and associated proteins
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-100922-163 Predicted to enable protein kinase binding activity. Predicted to be involved in centriole replication; centrosome-templated microtubule nucleation; and mitotic spindle assembly. Predicted to act upstream of or within centrosome duplication and protein localization to centrosome. Predicted to be active in centriole; cytoplasm; and pericentriolar material. Orthologous to human CEP192 (centrosomal protein 192).

Ensembl:

ensembl_id ENSDART00000167870

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00020557 lncRNA downstream 47365 10205110 ~ 10207842 (-) False XLOC_010469
TCONS_00020554 lncRNA downstream 189327 10064926 ~ 10065880 (-) False XLOC_010468
TCONS_00022118 lncRNA downstream 241602 10012985 ~ 10013605 (-) True XLOC_010466
TCONS_00022117 lncRNA downstream 493454 9759176 ~ 9761753 (-) True XLOC_010461
TCONS_00020541 lncRNA downstream 688836 9564503 ~ 9566371 (-) True XLOC_010458
TCONS_00022119 lncRNA upstream 159545 10421170 ~ 10429820 (-) False XLOC_010472
TCONS_00022120 lncRNA upstream 159545 10421170 ~ 10429893 (-) True XLOC_010472
TCONS_00022121 lncRNA upstream 164122 10425747 ~ 10428540 (-) True XLOC_010473
TCONS_00022122 lncRNA upstream 588081 10849706 ~ 10859614 (-) True XLOC_010477
TCONS_00022123 lncRNA upstream 655959 10917584 ~ 10919434 (-) True XLOC_010479
TCONS_00020558 mRNA downstream 31466 10213451 ~ 10223741 (-) False XLOC_010469
TCONS_00020555 mRNA downstream 183320 10065512 ~ 10071887 (-) True XLOC_010468
TCONS_00020553 mRNA downstream 183321 10055492 ~ 10071886 (-) False XLOC_010468
TCONS_00020552 mRNA downstream 202158 10025896 ~ 10053049 (-) True XLOC_010467
TCONS_00020551 mRNA downstream 274805 9977858 ~ 9980402 (-) True XLOC_010465
TCONS_00020560 mRNA upstream 25963 10287588 ~ 10316359 (-) True XLOC_010470
TCONS_00020561 mRNA upstream 135815 10397440 ~ 10404383 (-) True XLOC_010471
TCONS_00020562 mRNA upstream 215908 10477533 ~ 10516970 (-) True XLOC_010474
TCONS_00020563 mRNA upstream 260971 10522596 ~ 10547781 (-) True XLOC_010475
TCONS_00020564 mRNA upstream 567162 10828787 ~ 10837245 (-) False XLOC_010476
TCONS_00020535 other downstream 953013 9302079 ~ 9302194 (-) True XLOC_010455
TCONS_00020526 other downstream 1776198 8478880 ~ 8479009 (-) True XLOC_010450
TCONS_00020525 other downstream 1859648 8372265 ~ 8395559 (-) True XLOC_010449
TCONS_00020521 other downstream 1966760 8287771 ~ 8288447 (-) True XLOC_010447
TCONS_00020507 other downstream 2558991 7694794 ~ 7696216 (-) True XLOC_010438
TCONS_00020565 other upstream 568184 10829809 ~ 10837232 (-) False XLOC_010476
TCONS_00020567 other upstream 654665 10916290 ~ 10916404 (-) True XLOC_010478
TCONS_00020572 other upstream 1499294 11760919 ~ 11779472 (-) False XLOC_010484
TCONS_00020591 other upstream 1750449 12012074 ~ 12012188 (-) True XLOC_010492
TCONS_00020603 other upstream 1977782 12239407 ~ 12239460 (-) True XLOC_010497

Expression Profile

//