RNA id: TCONS_00020577


Basic Information

Item Value
RNA id TCONS_00020577
length 326
RNA type mRNA
GC content 0.48
exon number 4
gene id XLOC_010484
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 11760602 ~ 11779661 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCCTGGTTCGATATTCCTGTTTCCGGGGTTTGGCAGCTGACCGCTGGCTGACTGATTCAACACAAAACTCTGCTGTAGAACATTTGTCGTGATGAGTGGAGATTCAAACCCTGCAGCCACACCCACCCCCTGTCAGGACATACAGGGAGATGGACGATGGATGTCATTGCACAATCGATTTGTATCAGACAGTAAAGGAAAAGAGCCTGATGTTCTGTTTGTTGGAGATTCACTCATCCAGCTTCTGCATGAGTTTGAGGTTTGGAGAAAATTGTTTTCTCCTCTCCACGCTCTAAACTTTGGGATTGGTGGAGATGCTACGCAGC

Function

GO:

id name namespace
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1026 Predicted to enable hydrolase activity. Predicted to act upstream of or within lipid catabolic process. Orthologous to human PAFAH1B3 (platelet activating factor acetylhydrolase 1b catalytic subunit 3).

Ensembl:

ensembl_id ENSDART00000136329

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00022126 lncRNA downstream 138799 11597384 ~ 11639472 (-) True XLOC_010483
TCONS_00022125 lncRNA downstream 239450 11530885 ~ 11538821 (-) True XLOC_010482
TCONS_00020570 lncRNA downstream 239903 11437869 ~ 11538368 (-) False XLOC_010482
TCONS_00021786 lncRNA downstream 537051 11234889 ~ 11241220 (-) True XLOC_010481
TCONS_00022124 lncRNA downstream 766619 10980052 ~ 11011652 (-) True XLOC_010480
TCONS_00022127 lncRNA upstream 181122 11960630 ~ 11961493 (-) False XLOC_010489
TCONS_00022128 lncRNA upstream 182177 11961685 ~ 11963079 (-) True XLOC_010489
TCONS_00022129 lncRNA upstream 213058 11992566 ~ 12005084 (-) True XLOC_010491
TCONS_00020593 lncRNA upstream 272798 12052306 ~ 12054234 (-) False XLOC_010493
TCONS_00020617 lncRNA upstream 699189 12478697 ~ 12481849 (-) False XLOC_010505
TCONS_00020571 mRNA downstream 12006 11760602 ~ 11766265 (-) False XLOC_010484
TCONS_00020568 mRNA downstream 536847 11227246 ~ 11241424 (-) False XLOC_010481
TCONS_00020569 mRNA downstream 542699 11227946 ~ 11235572 (-) False XLOC_010481
TCONS_00020564 mRNA downstream 941026 10828787 ~ 10837245 (-) False XLOC_010476
TCONS_00020578 mRNA upstream 6459 11785967 ~ 11788044 (-) False XLOC_010485
TCONS_00020579 mRNA upstream 6546 11786054 ~ 11789108 (-) True XLOC_010485
TCONS_00020580 mRNA upstream 11132 11790640 ~ 11798994 (-) True XLOC_010486
TCONS_00020581 mRNA upstream 73704 11853212 ~ 11858009 (-) False XLOC_010487
TCONS_00020582 mRNA upstream 73949 11853457 ~ 11859309 (-) True XLOC_010487
TCONS_00020567 other downstream 861867 10916290 ~ 10916404 (-) True XLOC_010478
TCONS_00020565 other downstream 941039 10829809 ~ 10837232 (-) False XLOC_010476
TCONS_00020559 other downstream 1516646 10255207 ~ 10261625 (-) True XLOC_010469
TCONS_00020535 other downstream 2476077 9302079 ~ 9302194 (-) True XLOC_010455
TCONS_00020526 other downstream 3299262 8478880 ~ 8479009 (-) True XLOC_010450
TCONS_00020591 other upstream 232566 12012074 ~ 12012188 (-) True XLOC_010492
TCONS_00020603 other upstream 459899 12239407 ~ 12239460 (-) True XLOC_010497
TCONS_00020604 other upstream 468354 12247862 ~ 12247920 (-) True XLOC_010498
TCONS_00020605 other upstream 470760 12250268 ~ 12250323 (-) True XLOC_010499
TCONS_00020606 other upstream 473907 12253415 ~ 12253471 (-) True XLOC_010500

Expression Profile

//