RNA id: TCONS_00001657


Basic Information

Item Value
RNA id TCONS_00001657
length 751
RNA type processed_transcript
GC content 0.46
exon number 5
gene id XLOC_001036
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 10063501 ~ 10071539 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTTCGACTTCTGGACGCTCTGAAGTCGCAGGTCAAAGATCAAGTTGTTGTAATGCAGCGGCTTGAGGTTGACATTGACATCAAACTACGCACATGCAAAGGCTCTTGTGCCAGCTACAGCGAGTTCTCGGTGGACAGGGAAAGCTATGTGACTTTGGACAAGCAAATGGACAATCTGAACGCCATGCGTGTACAGAGCGTGGAGACTGTCAGTTCCTTGGGAATCATGAAGAGCAGGCCGTTGAAGGATGTGTTGGTGCCCACCATTTATAAGAGCGGAACGGGCAAAGCTGAGCAGAAGCTGCTTTTTGGAGATGTAGGCCAGATGCAGCTCTCTCTGGAAGCTGAAGGCTCCACTGCCGAATCTGCCGCCACAGTTAGCAAGTTTCCCACATCAGTGTGTACAGCCTTGAAATCCAGTCAGAAACAACATATTCACTATGATTACAGCAGATCTGGACAGTGTCCAGCACGACCAACATACCCTTTGTGCTCTGATGAGGAGATGGAGGATAAATGTCCATCTGGGTGTCGACTGGAGGGTCTTATTATTGTGGCAGATGAAGATATTTATAAACGTCTGAGAAAGACTTGTGAAAAGATTCAACAACATCAGGATGCCATTTCATTAGTGATGCAAAAGAGTGTCAAGTTTTATGAGTGTCAAAGGAAAACTATCGTCCAAACTTATATGCAAGAGCTCAGATATGCTGAATTTGCTGAAGATATTCACAAAAACCTCACGTTCCTGC

Function

GO:

id name namespace
GO:0072378 blood coagulation, fibrin clot formation biological_process
GO:0030168 platelet activation biological_process
GO:0007596 blood coagulation biological_process
GO:0051258 protein polymerization biological_process
GO:0062023 collagen-containing extracellular matrix cellular_component
GO:0005577 fibrinogen complex cellular_component
GO:0005615 extracellular space cellular_component
GO:0005102 signaling receptor binding molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko04611 Platelet activation
ko04613 Neutrophil extracellular trap formation
ko05171 Coronavirus disease - COVID-19
ko04147 Exosome
ko00536 Glycosaminoglycan binding proteins

ZFIN:

id description
ZDB-GENE-031010-21 Predicted to enable signaling receptor binding activity. Acts upstream of or within blood coagulation, fibrin clot formation. Predicted to be located in extracellular region. Predicted to be part of fibrinogen complex. Predicted to be active in collagen-containing extracellular matrix and extracellular space. Is expressed in liver and yolk syncytial layer. Used to study vascular hemostatic disease. Human ortholog(s) of this gene implicated in congenital afibrinogenemia; familial visceral amyloidosis; and thrombophilia. Orthologous to human FGA (fibrinogen alpha chain).

Ensembl:

ensembl_id ENSDART00000148074

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00001651 lncRNA downstream 83064 9972696 ~ 9980810 (-) False XLOC_001033
TCONS_00001652 lncRNA downstream 83064 9979294 ~ 9980810 (-) True XLOC_001033
TCONS_00003341 lncRNA downstream 145062 9916376 ~ 9918812 (-) True XLOC_001031
TCONS_00003340 lncRNA downstream 641599 9420824 ~ 9422275 (-) True XLOC_001024
TCONS_00001627 lncRNA downstream 741943 9314508 ~ 9321931 (-) True XLOC_001023
TCONS_00001676 lncRNA upstream 603319 10671852 ~ 10682149 (-) True XLOC_001044
TCONS_00003342 lncRNA upstream 670632 10739165 ~ 10740441 (-) True XLOC_001045
TCONS_00001690 lncRNA upstream 804484 10873017 ~ 10885338 (-) False XLOC_001048
TCONS_00003343 lncRNA upstream 868191 10936724 ~ 10937815 (-) True XLOC_001050
TCONS_00003344 lncRNA upstream 1402257 11470790 ~ 11517353 (-) True XLOC_001054
TCONS_00001655 mRNA downstream 15360 10037444 ~ 10048514 (-) False XLOC_001035
TCONS_00001654 mRNA downstream 15360 10037444 ~ 10048514 (-) True XLOC_001035
TCONS_00001653 mRNA downstream 75034 9986675 ~ 9988840 (-) True XLOC_001034
TCONS_00001650 mRNA downstream 83109 9972565 ~ 9980765 (-) False XLOC_001033
TCONS_00001649 mRNA downstream 123380 9919909 ~ 9940494 (-) True XLOC_001032
TCONS_00001663 mRNA upstream 268148 10336681 ~ 10347198 (-) False XLOC_001038
TCONS_00001664 mRNA upstream 268152 10336685 ~ 10347307 (-) True XLOC_001038
TCONS_00001665 mRNA upstream 394159 10462692 ~ 10473630 (-) True XLOC_001039
TCONS_00001666 mRNA upstream 417560 10486093 ~ 10578013 (-) False XLOC_001040
TCONS_00001667 mRNA upstream 418349 10486882 ~ 10620345 (-) False XLOC_001040
TCONS_00001646 other downstream 246999 9740802 ~ 9816875 (-) True XLOC_001029
TCONS_00001629 other downstream 577794 9460010 ~ 9486080 (-) False XLOC_001025
TCONS_00001617 other downstream 865908 9197859 ~ 9197966 (-) True XLOC_001018
TCONS_00001610 other downstream 945203 9118100 ~ 9118671 (-) False XLOC_001012
TCONS_00001595 other downstream 1411219 8650109 ~ 8652655 (-) False XLOC_001004
TCONS_00001662 other upstream 201714 10270247 ~ 10272725 (-) True XLOC_001037
TCONS_00001669 other upstream 551283 10619816 ~ 10620459 (-) True XLOC_001040
TCONS_00001683 other upstream 756127 10824660 ~ 10841378 (-) False XLOC_001048
TCONS_00001684 other upstream 756127 10824660 ~ 10849951 (-) False XLOC_001048
TCONS_00001689 other upstream 801584 10870117 ~ 10870241 (-) True XLOC_001049

Expression Profile

//