RNA id: TCONS_00020757


Basic Information

Item Value
RNA id TCONS_00020757
length 90
RNA type miRNA
GC content 0.31
exon number 1
gene id XLOC_010592
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 17704830 ~ 17706764 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TGTTACAGACTATGTGATATGTTTGATATTCGGTTGCTTTCTTTATATCATGTCAACTAAATATCAGACATATTCCTATAGACTGTGACA

Function

GO:

id name namespace
GO:0034220 ion transmembrane transport biological_process
GO:0050953 sensory perception of light stimulus biological_process
GO:0002088 lens development in camera-type eye biological_process
GO:0098655 cation transmembrane transport biological_process
GO:0007601 visual perception biological_process
GO:0009449 gamma-aminobutyric acid biosynthetic process biological_process
GO:0045111 intermediate filament cytoskeleton cellular_component
GO:0042995 cell projection cellular_component
GO:0043005 neuron projection cellular_component
GO:0120025 plasma membrane bounded cell projection cellular_component
GO:0005882 intermediate filament cellular_component
GO:0097458 obsolete neuron part cellular_component
GO:0022890 inorganic cation transmembrane transporter activity molecular_function
GO:0015318 inorganic molecular entity transmembrane transporter activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function
GO:0004351 glutamate decarboxylase activity molecular_function
GO:0015075 ion transmembrane transporter activity molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000115728

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00021793 lncRNA downstream 23946 17679103 ~ 17681952 (-) True XLOC_010591
TCONS_00020736 lncRNA downstream 465060 17235282 ~ 17240838 (-) True XLOC_010581
TCONS_00020732 lncRNA downstream 508297 17194073 ~ 17197601 (-) False XLOC_010579
TCONS_00022136 lncRNA downstream 673087 17015188 ~ 17032811 (-) True XLOC_010573
TCONS_00020715 lncRNA downstream 1039141 16665854 ~ 16666757 (-) False XLOC_010571
TCONS_00022138 lncRNA upstream 117460 17823447 ~ 17824848 (-) True XLOC_010594
TCONS_00022139 lncRNA upstream 431655 18137642 ~ 18140068 (-) True XLOC_010595
TCONS_00021794 lncRNA upstream 439430 18145417 ~ 18149149 (-) False XLOC_010596
TCONS_00020759 lncRNA upstream 439906 18145893 ~ 18150006 (-) False XLOC_010596
TCONS_00020760 lncRNA upstream 440271 18146258 ~ 18150003 (-) True XLOC_010596
TCONS_00020755 mRNA downstream 6787 17671301 ~ 17699111 (-) False XLOC_010591
TCONS_00020754 mRNA downstream 45304 17639896 ~ 17660594 (-) True XLOC_010590
TCONS_00020752 mRNA downstream 119015 17579915 ~ 17586883 (-) False XLOC_010589
TCONS_00020751 mRNA downstream 119828 17578607 ~ 17586070 (-) False XLOC_010589
TCONS_00020753 mRNA downstream 119830 17580872 ~ 17586068 (-) True XLOC_010589
TCONS_00020758 mRNA upstream 5228 17711215 ~ 17713859 (-) True XLOC_010593
TCONS_00020766 mRNA upstream 902991 18608978 ~ 18652646 (-) True XLOC_010600
TCONS_00020767 mRNA upstream 983943 18689930 ~ 18702249 (-) False XLOC_010601
TCONS_00020768 mRNA upstream 988843 18694830 ~ 18960333 (-) False XLOC_010601
TCONS_00020771 mRNA upstream 1253366 18959353 ~ 18960613 (-) True XLOC_010601
TCONS_00020738 other downstream 458535 17247222 ~ 17247363 (-) True XLOC_010583
TCONS_00020737 other downstream 460851 17244908 ~ 17245047 (-) True XLOC_010582
TCONS_00020724 other downstream 576432 17121998 ~ 17129466 (-) False XLOC_010577
TCONS_00020722 other downstream 585712 17120064 ~ 17120186 (-) True XLOC_010576
TCONS_00020716 other downstream 1013631 16677708 ~ 16692267 (-) True XLOC_010571
TCONS_00020761 other upstream 662927 18368914 ~ 18372540 (-) True XLOC_010597
TCONS_00020762 other upstream 789553 18495540 ~ 18501141 (-) False XLOC_010598
TCONS_00020763 other upstream 791308 18497295 ~ 18501141 (-) False XLOC_010598
TCONS_00020764 other upstream 791567 18497554 ~ 18501117 (-) True XLOC_010598
TCONS_00020765 other upstream 874737 18580724 ~ 18583338 (-) True XLOC_010599