RNA id: TCONS_00020784


Basic Information

Item Value
RNA id TCONS_00020784
length 622
lncRNA type lincRNA
GC content 0.36
exon number 3
gene id XLOC_010611
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 19626526 ~ 19627832 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

atgctgaagttgccttttgcactctggaatttaagggccgtgttgcagacacaaattgtttgtctgtgctggagaccagaggggaagctgtctttaaaaggatggggctcttataccatatgtgaagttacctattcaggtgctttttgggcacctgtttggagatggaagacagacgaagtcaaagaagcagagaagacacatcaaccagcaagtgtgtaaaattatcaggaaaatgattgactttgaatagacgactgccttatttagcaagaagttttgtctctctctctctcatgtgtatatatatatatatataatgagagacagagagagcgcactctgaagcactgctttttatatgtatgctacatatgatgtcagatttttttatgaatatgttcttatagtattttttgaggcttcacctgcaccttttgaaagttttctgaaatgtttacacagatgtcattaagctgttaaataaatctgtaaaatgtatgtgtgtttgtttttattttgattttagagtcttctcagatcacccaaaaatgaagattcggtcgtcatttacgcatcctcaggttgtttggacacaaagaggattatttgatatttttat

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0022607 cellular component assembly biological_process
GO:0001732 formation of cytoplasmic translation initiation complex biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0019538 protein metabolic process biological_process
GO:0043603 cellular amide metabolic process biological_process
GO:0043604 amide biosynthetic process biological_process
GO:0030163 protein catabolic process biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:1901565 organonitrogen compound catabolic process biological_process
GO:0009057 macromolecule catabolic process biological_process
GO:1901566 organonitrogen compound biosynthetic process biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:0043632 modification-dependent macromolecule catabolic process biological_process
GO:0006412 translation biological_process
GO:0006413 translational initiation biological_process
GO:0043933 protein-containing complex subunit organization biological_process
GO:0044257 cellular protein catabolic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044265 cellular macromolecule catabolic process biological_process
GO:0044267 cellular protein metabolic process biological_process
GO:0010498 proteasomal protein catabolic process biological_process
GO:0010499 proteasomal ubiquitin-independent protein catabolic process biological_process
GO:0019941 modification-dependent protein catabolic process biological_process
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process biological_process
GO:0006511 ubiquitin-dependent protein catabolic process biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0051603 proteolysis involved in cellular protein catabolic process biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0002183 cytoplasmic translational initiation biological_process
GO:0043248 proteasome assembly biological_process
GO:0071013 catalytic step 2 spliceosome cellular_component
GO:0044391 ribosomal subunit cellular_component
GO:0019773 proteasome core complex, alpha-subunit complex cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044444 obsolete cytoplasmic part cellular_component
GO:0005829 cytosol cellular_component
GO:0005839 proteasome core complex cellular_component
GO:0005840 ribosome cellular_component
GO:0005852 eukaryotic translation initiation factor 3 complex cellular_component
GO:0005854 nascent polypeptide-associated complex cellular_component
GO:0030532 small nuclear ribonucleoprotein complex cellular_component
GO:1905368 peptidase complex cellular_component
GO:1905369 endopeptidase complex cellular_component
GO:0032991 protein-containing complex cellular_component
GO:0015934 large ribosomal subunit cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0033290 eukaryotic 48S preinitiation complex cellular_component
GO:0000502 proteasome complex cellular_component
GO:1902494 catalytic complex cellular_component
GO:0016282 eukaryotic 43S preinitiation complex cellular_component
GO:0005685 U1 snRNP cellular_component
GO:0097525 spliceosomal snRNP complex cellular_component
GO:0070993 translation preinitiation complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008135 translation factor activity, RNA binding molecular_function
GO:0070003 threonine-type peptidase activity molecular_function
GO:0004298 threonine-type endopeptidase activity molecular_function
GO:0003723 RNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function
GO:0003743 translation initiation factor activity molecular_function
GO:0051082 unfolded protein binding molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDART00000194084

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00020783 lncRNA downstream 7927 19617088 ~ 19618599 (-) True XLOC_010610
TCONS_00020782 lncRNA downstream 8452 19617088 ~ 19618074 (-) False XLOC_010610
TCONS_00021796 lncRNA downstream 128722 19495744 ~ 19497804 (-) True XLOC_010608
TCONS_00020774 lncRNA downstream 475783 19145147 ~ 19150743 (-) True XLOC_010604
TCONS_00020770 lncRNA downstream 665940 18896967 ~ 18960586 (-) False XLOC_010601
TCONS_00020785 lncRNA upstream 3582 19631414 ~ 19633025 (-) False XLOC_010612
TCONS_00020786 lncRNA upstream 3963 19631795 ~ 19634470 (-) True XLOC_010612
TCONS_00021797 lncRNA upstream 179696 19807528 ~ 19821312 (-) True XLOC_010613
TCONS_00022141 lncRNA upstream 183802 19811634 ~ 19813669 (-) False XLOC_010614
TCONS_00022142 lncRNA upstream 183802 19811634 ~ 19813802 (-) True XLOC_010614
TCONS_00020780 mRNA downstream 57731 19537038 ~ 19568795 (-) False XLOC_010609
TCONS_00020781 mRNA downstream 58138 19540517 ~ 19568388 (-) True XLOC_010609
TCONS_00020778 mRNA downstream 253216 19306522 ~ 19373310 (-) True XLOC_010605
TCONS_00020776 mRNA downstream 277208 19182712 ~ 19349318 (-) False XLOC_010605
TCONS_00020775 mRNA downstream 372203 19181163 ~ 19254323 (-) False XLOC_010605
TCONS_00020788 mRNA upstream 212314 19840146 ~ 20006270 (-) False XLOC_010616
TCONS_00020789 mRNA upstream 214702 19842534 ~ 19890366 (-) False XLOC_010616
TCONS_00020791 mRNA upstream 236775 19864607 ~ 19890303 (-) False XLOC_010616
TCONS_00020794 mRNA upstream 384358 20012190 ~ 20038263 (-) False XLOC_010617
TCONS_00020795 mRNA upstream 385995 20013827 ~ 20038263 (-) True XLOC_010617
TCONS_00020779 other downstream 202393 19422295 ~ 19424133 (-) True XLOC_010607
TCONS_00020777 other downstream 435895 19190514 ~ 19190631 (-) True XLOC_010606
TCONS_00020769 other downstream 762140 18864270 ~ 18864386 (-) True XLOC_010602
TCONS_00020765 other downstream 1043188 18580724 ~ 18583338 (-) True XLOC_010599
TCONS_00020764 other downstream 1125409 18497554 ~ 18501117 (-) True XLOC_010598
TCONS_00020792 other upstream 248438 19876270 ~ 19882947 (-) False XLOC_010616
TCONS_00020793 other upstream 251012 19878844 ~ 19970367 (-) True XLOC_010616
TCONS_00020802 other upstream 765861 20393693 ~ 20393809 (-) True XLOC_010623
TCONS_00020803 other upstream 774388 20402220 ~ 20492696 (-) True XLOC_010622
TCONS_00020809 other upstream 1267280 20895112 ~ 20895175 (-) True XLOC_010626

Expression Profile

//