RNA id: TCONS_00020801


Basic Information

Item Value
RNA id TCONS_00020801
length 611
lncRNA type retained_intron
GC content 0.53
exon number 3
gene id XLOC_010622
representative False

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 20318400 ~ 20492799 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CACTGCAGGACAAACTCAGCTGCTGCTTTCATTCCACATCATACTCATCCTCCTCCACAGAGGAGATGCAGGCTCTTCCCAAAGCCAGAGCCCAAGTTGGTGGCATTATGGGGTCGGCAGTAGGTGAATTAGCCCCCCACAAAGCCAAGCAGAAGGAGCGCAAGCACCAGGAGTTGTTGGCATTGGCTCTGGGCGTGAATCTGGGCAGCAGGGGTGCTCTTCTCTGGAAACCTCTAAAGATTTTGGCTTGTTCACAGATCAGCCCATCGCCGCTGAGCAGACGGACCACACTCAAAGATGGACCAGAGAAACACTGTAACTATGAGAAGATACACAACTTTAAGGTGCACACGTTCAGGGGGCCGCACTGGTGTGAATACTGCGCTAACTTCATGTGGGGTCTCATCGCTCAGGGCGTCCGTTGTTCAGACTGTGGACTCAATGTGCACAAGCAGTGCTCCAAACTGGTGCCCAGTGACTGTCAGCCAGACCTGCGCAGGATCAAGAAGGTTTTCAGCTGCGATCTCACCACACTGGTCAAAGCACACAACACGCCGAGGCCCATGGTTCTGGACATGTGTATCAGAGAGATCGAACACAGAGGTACTGAA

Function

GO:

id name namespace
GO:0043547 positive regulation of GTPase activity biological_process
GO:0035556 intracellular signal transduction biological_process
GO:0043087 regulation of GTPase activity biological_process
GO:0051056 regulation of small GTPase mediated signal transduction biological_process
GO:0007165 signal transduction biological_process
GO:0005096 GTPase activator activity molecular_function
GO:0046872 metal ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-091020-5 Predicted to enable GTPase activator activity. Predicted to be involved in regulation of GTPase activity. Predicted to act upstream of or within intracellular signal transduction; positive regulation of GTPase activity; and regulation of small GTPase mediated signal transduction. Orthologous to human CHN2 (chimerin 2).

Ensembl:

ensembl_id ENSDART00000145452

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00020798 lncRNA downstream 15372 20309370 ~ 20312666 (-) True XLOC_010621
TCONS_00022144 lncRNA downstream 15869 20309370 ~ 20312169 (-) False XLOC_010621
TCONS_00022143 lncRNA downstream 175313 20149577 ~ 20152725 (-) True XLOC_010619
TCONS_00021798 lncRNA downstream 284762 20041866 ~ 20043276 (-) True XLOC_010618
TCONS_00020796 lncRNA downstream 284953 20041857 ~ 20043085 (-) False XLOC_010618
TCONS_00022145 lncRNA upstream 551816 20923482 ~ 20927125 (-) True XLOC_010627
TCONS_00022146 lncRNA upstream 559919 20931585 ~ 20934597 (-) False XLOC_010625
TCONS_00020812 lncRNA upstream 559919 20931585 ~ 20934737 (-) False XLOC_010625
TCONS_00022147 lncRNA upstream 559919 20931585 ~ 20934737 (-) False XLOC_010625
TCONS_00020810 lncRNA upstream 559919 20931585 ~ 20934737 (-) False XLOC_010625
TCONS_00020797 mRNA downstream 33802 20265499 ~ 20294236 (-) True XLOC_010620
TCONS_00020794 mRNA downstream 289775 20012190 ~ 20038263 (-) False XLOC_010617
TCONS_00020795 mRNA downstream 289775 20013827 ~ 20038263 (-) True XLOC_010617
TCONS_00020789 mRNA downstream 437672 19842534 ~ 19890366 (-) False XLOC_010616
TCONS_00020804 mRNA upstream 157534 20529200 ~ 20707742 (-) True XLOC_010624
TCONS_00020805 mRNA upstream 433656 20805322 ~ 20855730 (-) False XLOC_010625
TCONS_00020806 mRNA upstream 433656 20805322 ~ 20932896 (-) False XLOC_010625
TCONS_00020807 mRNA upstream 434267 20805933 ~ 20870205 (-) False XLOC_010625
TCONS_00020808 mRNA upstream 434271 20805937 ~ 20870143 (-) False XLOC_010625
TCONS_00020793 other downstream 357671 19878844 ~ 19970367 (-) True XLOC_010616
TCONS_00020792 other downstream 445091 19876270 ~ 19882947 (-) False XLOC_010616
TCONS_00020779 other downstream 903905 19422295 ~ 19424133 (-) True XLOC_010607
TCONS_00020777 other downstream 1137407 19190514 ~ 19190631 (-) True XLOC_010606
TCONS_00020769 other downstream 1463652 18864270 ~ 18864386 (-) True XLOC_010602
TCONS_00020802 other upstream 22027 20393693 ~ 20393809 (-) True XLOC_010623
TCONS_00020803 other upstream 30554 20402220 ~ 20492696 (-) True XLOC_010622
TCONS_00020809 other upstream 523446 20895112 ~ 20895175 (-) True XLOC_010626
TCONS_00020827 other upstream 1079489 21451155 ~ 21451284 (-) True XLOC_010635
TCONS_00020829 other upstream 1084288 21455954 ~ 21463718 (-) False XLOC_010634

Expression Profile

//