RNA id: TCONS_00021089


Basic Information

Item Value
RNA id TCONS_00021089
length 224
RNA type processed_transcript
GC content 0.39
exon number 3
gene id XLOC_010782
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 29685557 ~ 29690212 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGACATCACTACCCATAATTCCACATAGAAACAGGAAGTACAAGAGAGGAGTTTGTAAGCTTTTGGCAGCAAAATAAGAAAACACTGTTTAGTTTCTGGAAGAATAGGTCGCCAAGCATGTCTTTCAAAAGAGAAGGGGATGATCAAAGCCAGCTTAATATACTGAAGATGATGAAGCTACTCTGATGAAAAACGGAAGATACAGTTGTCTTGTGTGTTCTCAC

Function

GO:

id name namespace
GO:0000380 alternative mRNA splicing, via spliceosome biological_process
GO:0006397 mRNA processing biological_process
GO:0008380 RNA splicing biological_process
GO:0005634 nucleus cellular_component
GO:0016607 nuclear speck cellular_component
GO:0046872 metal ion binding molecular_function

KEGG:

id description
ko03041 Spliceosome

ZFIN:

id description
ZDB-GENE-030131-415 Predicted to enable metal ion binding activity. Predicted to be involved in alternative mRNA splicing, via spliceosome. Predicted to act upstream of or within mRNA processing. Predicted to be located in nuclear speck. Predicted to be active in nucleus. Orthologous to human SCNM1 (sodium channel modifier 1).

Ensembl:

ensembl_id ENSDART00000133965

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00022176 lncRNA downstream 38983 29647214 ~ 29650725 (-) True XLOC_010781
TCONS_00022175 lncRNA downstream 150755 29531348 ~ 29538953 (-) True XLOC_010779
TCONS_00022174 lncRNA downstream 156034 29531348 ~ 29533674 (-) False XLOC_010779
TCONS_00021068 lncRNA downstream 525477 29135068 ~ 29164231 (-) False XLOC_010768
TCONS_00021067 lncRNA downstream 582147 29096898 ~ 29107561 (-) False XLOC_010768
TCONS_00021809 lncRNA upstream 229383 29919595 ~ 29921770 (-) True XLOC_010784
TCONS_00021095 lncRNA upstream 729258 30419470 ~ 30421222 (-) True XLOC_010785
TCONS_00021097 lncRNA upstream 814304 30504516 ~ 30519239 (-) False XLOC_010787
TCONS_00022177 lncRNA upstream 827929 30518141 ~ 30519219 (-) True XLOC_010787
TCONS_00021102 lncRNA upstream 835300 30525512 ~ 30529738 (-) False XLOC_010788
TCONS_00021086 mRNA downstream 132370 29551023 ~ 29557338 (-) True XLOC_010780
TCONS_00021084 mRNA downstream 161510 29521736 ~ 29528198 (-) False XLOC_010778
TCONS_00021085 mRNA downstream 162296 29523132 ~ 29527412 (-) True XLOC_010778
TCONS_00021081 mRNA downstream 209373 29455974 ~ 29480335 (-) False XLOC_010776
TCONS_00021082 mRNA downstream 230902 29456918 ~ 29458806 (-) True XLOC_010776
TCONS_00021090 mRNA upstream 8353 29698565 ~ 29702447 (-) False XLOC_010783
TCONS_00021091 mRNA upstream 8999 29699211 ~ 29714540 (-) True XLOC_010783
TCONS_00021092 mRNA upstream 718485 30408697 ~ 30421275 (-) False XLOC_010785
TCONS_00021096 mRNA upstream 732269 30422481 ~ 30434279 (-) True XLOC_010786
TCONS_00021099 mRNA upstream 830145 30520357 ~ 30570161 (-) False XLOC_010788
TCONS_00021083 other downstream 159346 29515971 ~ 29530362 (-) True XLOC_010777
TCONS_00021070 other downstream 533856 29155738 ~ 29155852 (-) True XLOC_010769
TCONS_00021057 other downstream 881130 28799102 ~ 28808578 (-) False XLOC_010764
TCONS_00021035 other downstream 2091031 27595562 ~ 27598677 (-) False XLOC_010752
TCONS_00021003 other downstream 3310266 26378297 ~ 26379442 (-) True XLOC_010732
TCONS_00021093 other upstream 727642 30417854 ~ 30421018 (-) False XLOC_010785
TCONS_00021094 other upstream 728952 30419164 ~ 30420703 (-) False XLOC_010785
TCONS_00021103 other upstream 867497 30557709 ~ 30564289 (-) True XLOC_010788
TCONS_00021106 other upstream 958175 30648387 ~ 30648504 (-) True XLOC_010791
TCONS_00021115 other upstream 1047323 30737535 ~ 30774911 (-) False XLOC_010792

Expression Profile

//