RNA id: TCONS_00021234


Basic Information

Item Value
RNA id TCONS_00021234
length 318
RNA type mRNA
GC content 0.51
exon number 2
gene id XLOC_010850
representative False

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 33062570 ~ 33097398 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAATGCAGAGGAGTTGGAGCTCCTCGGTGACTCAAAGTATAGGAACTATGTGGCAGCAGTTGATAAGGCCTTAAAAAACTTTGAGTACTCCAGCGAATGGGCCGATTTGATCTCAGCGCTCGGAAAGCTCAACAAGGACTTCAGCAGCAAAGGCAACAGCCGCTCAGGACCATTTCACAGCCCTACTCCCAGAGACGGACCATTCCCTGGCAAGGATGGCAAACTGGAGAGCCAGAAAGTTTTCTGGAGCCGGGCCAGACAGAACATTGAGGAAATGGTTGAGAAGGACTTCCTCGAGGGCCTCATCAAAACGTGA

Function

GO:

id name namespace
GO:0006895 Golgi to endosome transport biological_process
GO:0005768 endosome cellular_component
GO:0005802 trans-Golgi network cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-050309-65 Predicted to act upstream of or within Golgi to endosome transport and protein transport. Predicted to be active in endosome and trans-Golgi network. Orthologous to human DOP1A (DOP1 leucine zipper like protein A).

Ensembl:

ensembl_id ENSDART00000187648

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00022194 lncRNA downstream 2803 33040999 ~ 33060053 (-) True XLOC_010849
TCONS_00021229 lncRNA downstream 86940 32888037 ~ 32975916 (-) True XLOC_010848
TCONS_00022193 lncRNA downstream 243091 32753486 ~ 32819765 (-) True XLOC_010847
TCONS_00022192 lncRNA downstream 243282 32753486 ~ 32819574 (-) False XLOC_010847
TCONS_00022191 lncRNA downstream 243326 32753486 ~ 32819530 (-) False XLOC_010847
TCONS_00022195 lncRNA upstream 465702 33560863 ~ 33592357 (-) False XLOC_010853
TCONS_00021240 lncRNA upstream 471836 33566997 ~ 33592335 (-) False XLOC_010853
TCONS_00021241 lncRNA upstream 487707 33582868 ~ 33592003 (-) False XLOC_010853
TCONS_00021242 lncRNA upstream 487707 33582868 ~ 33592106 (-) False XLOC_010853
TCONS_00022196 lncRNA upstream 492654 33587815 ~ 33592580 (-) True XLOC_010853
TCONS_00021230 mRNA downstream 3587 33005688 ~ 33059269 (-) False XLOC_010849
TCONS_00021232 mRNA downstream 3610 33008061 ~ 33059246 (-) False XLOC_010849
TCONS_00021231 mRNA downstream 3610 33008061 ~ 33059246 (-) False XLOC_010849
TCONS_00021228 mRNA downstream 61703 32843315 ~ 33001153 (-) False XLOC_010848
TCONS_00021226 mRNA downstream 86845 32832213 ~ 32976011 (-) False XLOC_010848
TCONS_00021236 mRNA upstream 6690 33101851 ~ 33105677 (-) False XLOC_010851
TCONS_00021238 mRNA upstream 9427 33104588 ~ 33104944 (-) True XLOC_010851
TCONS_00021243 mRNA upstream 550560 33645721 ~ 33650578 (-) True XLOC_010854
TCONS_00021245 mRNA upstream 677741 33772902 ~ 33816082 (-) False XLOC_010857
TCONS_00021246 mRNA upstream 678486 33773647 ~ 33817828 (-) False XLOC_010857
TCONS_00021210 other downstream 413052 32630074 ~ 32649804 (-) False XLOC_010844
TCONS_00021209 other downstream 488620 32574110 ~ 32574236 (-) True XLOC_010842
TCONS_00021200 other downstream 858427 32199452 ~ 32204429 (-) True XLOC_010833
TCONS_00021197 other downstream 899061 32152199 ~ 32163795 (-) True XLOC_010831
TCONS_00021196 other downstream 943253 32116671 ~ 32119603 (-) True XLOC_010830
TCONS_00021237 other upstream 8722 33103883 ~ 33104907 (-) False XLOC_010851
TCONS_00021239 other upstream 420605 33515766 ~ 33541958 (-) True XLOC_010852
TCONS_00021244 other upstream 654906 33750067 ~ 33758285 (-) True XLOC_010856
TCONS_00021255 other upstream 1205118 34300279 ~ 34306670 (-) False XLOC_010862
TCONS_00021256 other upstream 1207016 34302177 ~ 34305977 (-) True XLOC_010862

Expression Profile

//