RNA id: TCONS_00022681


Basic Information

Item Value
RNA id TCONS_00022681
length 304
RNA type mRNA
GC content 0.44
exon number 3
gene id XLOC_011390
representative False

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 21760032 ~ 21822840 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AATCTCCACCTTTAAATACAAGCCTTTTGTACAGCTGTTTTTTCATCAAAACGTTGTCCTTTCGTCGACCGCGTCATTTACAAGACTAGCAAGATGGAAACTGATAGAGCATCAGATAAGTTTATAACTGGAAGACTCTAGATCTTCAATGGGCGAGGAGAAGCCAGAACCACTGGATTTCGTGAAGGACTTTCAGGAGTACCTGAGCCAACAGACCCAACATGTCAACATGATATCAGGCTCTGTCATCGGTGTGAAAGACAGTGATGATCTGCAAGGAGAACTTGCTCAGAATGGCCTGGAG

Function

GO:

id name namespace
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0003140 determination of left/right asymmetry in lateral mesoderm biological_process
GO:0071908 determination of intestine left/right asymmetry biological_process
GO:0007368 determination of left/right symmetry biological_process
GO:0035469 determination of pancreatic left/right asymmetry biological_process
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040801-209 Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within determination of intestine left/right asymmetry; determination of left/right asymmetry in lateral mesoderm; and determination of pancreatic left/right asymmetry. Predicted to be located in nucleus. Is expressed in several structures, including brain; digestive system; eye; pharyngeal arch cartilage; and thymus. Human ortholog(s) of this gene implicated in thrombocytopenia. Orthologous to human IKZF5 (IKAROS family zinc finger 5).

Ensembl:

ensembl_id ENSDART00000136727

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00024680 lncRNA upstream 113511 21667797 ~ 21703491 (+) True XLOC_011389
TCONS_00024467 lncRNA upstream 726890 21089774 ~ 21090112 (+) True XLOC_011381
TCONS_00024679 lncRNA upstream 830626 20979252 ~ 20986376 (+) True XLOC_011380
TCONS_00024678 lncRNA upstream 876171 20938254 ~ 20940831 (+) True XLOC_011379
TCONS_00024466 lncRNA upstream 948466 20868310 ~ 20868536 (+) True XLOC_011377
TCONS_00024681 lncRNA downstream 250150 22069932 ~ 22071151 (+) True XLOC_011395
TCONS_00022700 lncRNA downstream 739273 22559055 ~ 22572656 (+) False XLOC_011400
TCONS_00024682 lncRNA downstream 739291 22559073 ~ 22572656 (+) True XLOC_011400
TCONS_00022711 lncRNA downstream 1402395 23222177 ~ 23232294 (+) True XLOC_011407
TCONS_00024683 lncRNA downstream 1583340 23403122 ~ 23404188 (+) True XLOC_011422
TCONS_00022678 mRNA upstream 253228 21546993 ~ 21563774 (+) True XLOC_011387
TCONS_00022677 mRNA upstream 255840 21514777 ~ 21561162 (+) False XLOC_011387
TCONS_00022675 mRNA upstream 322707 21477892 ~ 21494295 (+) False XLOC_011386
TCONS_00022676 mRNA upstream 322707 21486047 ~ 21494295 (+) True XLOC_011386
TCONS_00022674 mRNA upstream 349572 21452258 ~ 21467430 (+) True XLOC_011385
TCONS_00022686 mRNA downstream 68041 21887823 ~ 21913328 (+) False XLOC_011391
TCONS_00022687 mRNA downstream 68077 21887859 ~ 21913327 (+) False XLOC_011391
TCONS_00022688 mRNA downstream 82276 21902058 ~ 21912502 (+) True XLOC_011391
TCONS_00022690 mRNA downstream 99349 21919131 ~ 21959556 (+) True XLOC_011393
TCONS_00022691 mRNA downstream 144690 21964472 ~ 21982835 (+) False XLOC_011394
TCONS_00022679 other upstream 209293 21564607 ~ 21607709 (+) True XLOC_011388
TCONS_00022668 other upstream 1186687 20625773 ~ 20630315 (+) True XLOC_011374
TCONS_00022664 other upstream 1190183 20616016 ~ 20626819 (+) False XLOC_011374
TCONS_00022666 other upstream 1196057 20616199 ~ 20620945 (+) False XLOC_011374
TCONS_00022660 other upstream 1224044 20585328 ~ 20592958 (+) False XLOC_011372
TCONS_00022689 other downstream 97666 21917448 ~ 21917564 (+) True XLOC_011392
TCONS_00022702 other downstream 757848 22577630 ~ 22580193 (+) True XLOC_011401
TCONS_00022706 other downstream 940951 22760733 ~ 22782721 (+) True XLOC_011403
TCONS_00022707 other downstream 1007281 22827063 ~ 22827147 (+) True XLOC_011404
TCONS_00022712 other downstream 1404022 23223804 ~ 23223920 (+) True XLOC_011408