RNA id: TCONS_00022977


Basic Information

Item Value
RNA id TCONS_00022977
length 225
RNA type processed_transcript
GC content 0.50
exon number 2
gene id XLOC_011530
representative True

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 30749251 ~ 30817230 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACTCAGAATACCATTGCATCTAAGTGGCTGGATTTACTCTACACTACAAGCTCCGTTCACATTCATTACAGAAGGTTGTGAAGGCGGTGATGCTCTTCCCCACAATTGAGCGCATGGCCTGCAGTCCTCAAGGAAAAGTCATGACCCCTGTGCTCTGCCGCCTGCGATATGCCTTCTATTTGCCCATCTTCCTGCTCTCTCTCCTTCCAGAGAGGCTGAAAGTCG

Function

GO:

id name namespace
GO:0019915 lipid storage biological_process
GO:0005811 lipid droplet cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-081022-178 Predicted to be involved in lipid storage. Predicted to be active in lipid droplet. Orthologous to human LDAH (lipid droplet associated hydrolase).

Ensembl:

ensembl_id ENSDART00000154225

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00024471 lncRNA upstream 51701 30744729 ~ 30745172 (+) True XLOC_011529
TCONS_00022971 lncRNA upstream 207737 30587495 ~ 30589136 (+) True XLOC_011526
TCONS_00022960 lncRNA upstream 382566 30411712 ~ 30414307 (+) True XLOC_011523
TCONS_00022954 lncRNA upstream 1068130 29723351 ~ 29728743 (+) True XLOC_011521
TCONS_00024703 lncRNA upstream 1719031 29021960 ~ 29077842 (+) False XLOC_011517
TCONS_00022980 lncRNA downstream 50519 30848438 ~ 30849810 (+) True XLOC_011531
TCONS_00022982 lncRNA downstream 327236 31125155 ~ 31127838 (+) False XLOC_011533
TCONS_00022985 lncRNA downstream 327311 31125230 ~ 31127838 (+) False XLOC_011533
TCONS_00022984 lncRNA downstream 327311 31125230 ~ 31127838 (+) False XLOC_011533
TCONS_00022983 lncRNA downstream 327311 31125230 ~ 31127838 (+) True XLOC_011533
TCONS_00022976 mRNA upstream 24922 30751462 ~ 30771951 (+) False XLOC_011530
TCONS_00022974 mRNA upstream 68907 30704068 ~ 30727966 (+) True XLOC_011528
TCONS_00022972 mRNA upstream 191139 30591287 ~ 30605734 (+) False XLOC_011527
TCONS_00022968 mRNA upstream 205650 30545895 ~ 30591223 (+) False XLOC_011526
TCONS_00022967 mRNA upstream 207179 30522764 ~ 30589694 (+) False XLOC_011526
TCONS_00022978 mRNA downstream 45962 30843881 ~ 30855792 (+) False XLOC_011531
TCONS_00022979 mRNA downstream 45996 30843915 ~ 30848382 (+) False XLOC_011531
TCONS_00022981 mRNA downstream 96512 30894431 ~ 30900380 (+) True XLOC_011532
TCONS_00022986 mRNA downstream 387357 31185276 ~ 31202280 (+) True XLOC_011534
TCONS_00022987 mRNA downstream 423842 31221761 ~ 31228971 (+) True XLOC_011535
TCONS_00022973 other upstream 193266 30598373 ~ 30603607 (+) True XLOC_011527
TCONS_00022965 other upstream 300033 30496724 ~ 30496840 (+) True XLOC_011525
TCONS_00022963 other upstream 336380 30448532 ~ 30460493 (+) False XLOC_011524
TCONS_00022936 other upstream 2095590 28670177 ~ 28701283 (+) False XLOC_011513
TCONS_00022941 other upstream 2102855 28691129 ~ 28694018 (+) False XLOC_011513
TCONS_00023004 other downstream 1271339 32069258 ~ 32069372 (+) True XLOC_011547
TCONS_00023007 other downstream 1507764 32305683 ~ 32324919 (+) True XLOC_011549
TCONS_00023012 other downstream 1658884 32456803 ~ 32456919 (+) True XLOC_011554
TCONS_00023017 other downstream 1825012 32622931 ~ 32629551 (+) False XLOC_011558
TCONS_00023019 other downstream 1825024 32622943 ~ 32627740 (+) False XLOC_011558

Expression Profile

//