RNA id: TCONS_00023210


Basic Information

Item Value
RNA id TCONS_00023210
length 863
lncRNA type retained_intron
GC content 0.44
exon number 5
gene id XLOC_011697
representative False

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 45577326 ~ 45599190 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAAAAGCCAGTCATAGACAGAGAAGACGACGACTCCTTTGGGTGAAATTTCTCAACCTTGCATTTAAAGATTTTAAAATGCCTCCTCCAGTGGTTCCTCATGGCATGTGCCTGAAGGTTATGAATGACCGTAACATGAAGGGCGGCATGGGCTCTGACACAAATCCACTGAAGTTCATGGACCAAGACTACAACTTCCTGCAAGACTACTGTCTCAAGACAAGGCAGAGATTTGTTGATGAGTTTTTCCCACCAGACCTTCGTTCCATTGGCGAAGGGCTGCTGAAGCCTGAGGTCATGGCCCGAGTGGAGTGGATTAGACCAACGAAATTATATCCAGAAGCTGCTGAATTCGTTGTAGATACGGTGTCCAGGTTTGACTATGCCCAAGGGTTTATAGGAAACTGTTGGTTTCTGGCCTCTGTTGGTGCCTTAACATTTCAAAGCAAATTACTGCAAAAGGTTGTTCCAGATGGACAGTCACTCAGACACAATTACACTGGCTTATTTCACTTCAGGTTCTGGCGCTTTGGAAAATGGTTCGATGTAGTGATTGACGACAAGCTGCCAACAATCAATCGCCAGCTGATCTTTGTCAAATCTAAAACATATAATGAGTTCTGGCCAGCCTTGCTGGAGAAAGCATATGCCAAGTAAGTGCTGTTAAATCTTTAAAGTTATGAAATATAACCTCAAGCATATGTAAGCAATAGCGCTGTTGTTTTTAATACAAGCATGGTTGTAATTCATGTGCAGTAGTAATGCTCAAAATTTATGTCTGTTTCACTGCGGCGAAACAATTTAGAGCTAGAATGACTGTTGCAGGGTATGTGGCTCCTATGCTGACATGCACACCGGCCGAGT

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0005737 cytoplasm cellular_component
GO:0004198 calcium-dependent cysteine-type endopeptidase activity molecular_function
GO:0005509 calcium ion binding molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0008233 peptidase activity molecular_function
GO:0008234 cysteine-type peptidase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-080917-19 Predicted to enable calcium-dependent cysteine-type endopeptidase activity. Predicted to be involved in proteolysis. Predicted to be active in cytoplasm. Is expressed in epidermis.

Ensembl:

ensembl_id ENSDART00000153922

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00024762 lncRNA upstream 227362 45348023 ~ 45349995 (+) True XLOC_011691
TCONS_00023195 lncRNA upstream 376816 45199552 ~ 45200541 (+) False XLOC_011688
TCONS_00024761 lncRNA upstream 376816 45199871 ~ 45200541 (+) True XLOC_011688
TCONS_00024498 lncRNA upstream 376826 45193199 ~ 45200531 (+) False XLOC_011688
TCONS_00024760 lncRNA upstream 383421 45193180 ~ 45193936 (+) False XLOC_011688
TCONS_00023215 lncRNA downstream 58374 45639339 ~ 45640296 (+) False XLOC_011699
TCONS_00024499 lncRNA downstream 591714 46172679 ~ 46180237 (+) True XLOC_011704
TCONS_00024763 lncRNA downstream 874825 46455790 ~ 46464176 (+) True XLOC_011706
TCONS_00024764 lncRNA downstream 1162331 46743296 ~ 46825416 (+) True XLOC_011708
TCONS_00023236 lncRNA downstream 1270061 46851026 ~ 46854102 (+) True XLOC_011711
TCONS_00023208 mRNA upstream 58834 45472695 ~ 45518523 (+) True XLOC_011696
TCONS_00023206 mRNA upstream 94615 45472608 ~ 45482742 (+) False XLOC_011696
TCONS_00023205 mRNA upstream 118150 45454943 ~ 45459207 (+) True XLOC_011695
TCONS_00023204 mRNA upstream 125241 45413324 ~ 45452116 (+) True XLOC_011694
TCONS_00023203 mRNA upstream 166187 45405821 ~ 45411170 (+) False XLOC_011693
TCONS_00023212 mRNA downstream 21675 45602640 ~ 45621301 (+) False XLOC_011698
TCONS_00023213 mRNA downstream 26615 45607580 ~ 45620615 (+) True XLOC_011698
TCONS_00023214 mRNA downstream 58282 45639247 ~ 45647054 (+) False XLOC_011699
TCONS_00023217 mRNA downstream 67871 45648836 ~ 45678386 (+) False XLOC_011700
TCONS_00023218 mRNA downstream 73759 45654724 ~ 45677916 (+) True XLOC_011700
TCONS_00023207 other upstream 102108 45472654 ~ 45475249 (+) False XLOC_011696
TCONS_00023200 other upstream 174398 45396094 ~ 45402959 (+) True XLOC_011692
TCONS_00023189 other upstream 565501 45010043 ~ 45011856 (+) False XLOC_011685
TCONS_00023179 other upstream 1285837 44291405 ~ 44291520 (+) True XLOC_011677
TCONS_00023173 other upstream 1635306 43941937 ~ 43942051 (+) True XLOC_011671
TCONS_00023216 other downstream 58377 45639342 ~ 45646531 (+) True XLOC_011699
TCONS_00023224 other downstream 166718 45747683 ~ 45748668 (+) False XLOC_011701
TCONS_00023226 other downstream 227188 45808153 ~ 45808248 (+) True XLOC_011702
TCONS_00023227 other downstream 234388 45815353 ~ 45818477 (+) False XLOC_011703
TCONS_00023229 other downstream 334066 45915031 ~ 45955063 (+) False XLOC_011703

Expression Profile

//