RNA id: TCONS_00023956


Basic Information

Item Value
RNA id TCONS_00023956
length 530
RNA type processed_transcript
GC content 0.43
exon number 3
gene id XLOC_012154
representative True

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 27186948 ~ 27235797 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCTCCGGGGAGCTCTGGGTTTCAGTCTAAAATGAGCGACTGTCGAAGCACCGTGGCCGCGCTTGAGGAGTCCCTAGAGCAGGACCAGATGTCCCTACAGAAGATGAAGAAAATCGTGAAGGCCATCCACAACTCTGGACTGAATCATGTGGAGAATAAGGAGCAGTACACAGAGGTTCTGGAGAATCTGGGCAACAGTCACCTGTCGCAGGACAATAATGAGGTCTCCACAGGCTTCCTTAACCTGGCTGTGTTCACACGAGAGGTCACTGCACTCTTCAAAAACCTGGTGAGCAAAACAAAATCTCAAGGGTCAACTATATTTACTGAACACAATGATTTGACTATTTACTTTCCCTGTTTTATAATGAAGTAATAAAAACCTTTTCTGTAGTGATGGTCTGATTTATTTGGCTCATTTGAGATTATAGTTTGATAACCACATCTGAGCTATCACATTACAATAGGTCATTGGAGCTTAGTAATTACTGTGTAAGCTTACAGTTAATTTACCCATCATGACACTCCTAT

Function

GO:

id name namespace
GO:0043547 positive regulation of GTPase activity biological_process
GO:0016477 cell migration biological_process
GO:0005925 focal adhesion cellular_component
GO:0005096 GTPase activator activity molecular_function
GO:0046872 metal ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050913-39 Predicted to enable GTPase activator activity. Predicted to act upstream of or within cell migration and positive regulation of GTPase activity. Predicted to be located in cytoplasm and focal adhesion. Orthologous to human ASAP3 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 3).

Ensembl:

ensembl_id ENSDART00000038896

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00023948 lncRNA downstream 229132 26982035 ~ 26985759 (-) True XLOC_012152
TCONS_00024911 lncRNA downstream 246550 26950412 ~ 26968341 (-) True XLOC_012151
TCONS_00024910 lncRNA downstream 412155 26800971 ~ 26802736 (-) True XLOC_012147
TCONS_00023941 lncRNA downstream 413147 26783926 ~ 26801744 (-) False XLOC_012147
TCONS_00023937 lncRNA downstream 604104 26609651 ~ 26610787 (-) True XLOC_012145
TCONS_00024912 lncRNA upstream 167177 27402643 ~ 27403751 (-) True XLOC_012158
TCONS_00023965 lncRNA upstream 179198 27414664 ~ 27419261 (-) True XLOC_012159
TCONS_00023974 lncRNA upstream 864241 28099707 ~ 28101972 (-) False XLOC_012161
TCONS_00023975 lncRNA upstream 864241 28099707 ~ 28101975 (-) True XLOC_012161
TCONS_00023980 lncRNA upstream 1407992 28643458 ~ 28652512 (-) True XLOC_012166
TCONS_00023952 mRNA downstream 14257 27186948 ~ 27200634 (-) False XLOC_012154
TCONS_00023951 mRNA downstream 14866 27186948 ~ 27200025 (-) False XLOC_012154
TCONS_00023950 mRNA downstream 166251 26990620 ~ 27048640 (-) True XLOC_012153
TCONS_00023949 mRNA downstream 166354 26990531 ~ 27048537 (-) False XLOC_012153
TCONS_00023947 mRNA downstream 279552 26928418 ~ 26935339 (-) True XLOC_012150
TCONS_00023957 mRNA upstream 7981 27243447 ~ 27266053 (-) True XLOC_012155
TCONS_00023958 mRNA upstream 35933 27271399 ~ 27273296 (-) True XLOC_012156
TCONS_00023959 mRNA upstream 78622 27314088 ~ 27382868 (-) False XLOC_012157
TCONS_00023960 mRNA upstream 100077 27335543 ~ 27382868 (-) False XLOC_012157
TCONS_00023961 mRNA upstream 103074 27338540 ~ 27382826 (-) False XLOC_012157
TCONS_00023954 other downstream 9085 27203121 ~ 27205806 (-) False XLOC_012154
TCONS_00023944 other downstream 340851 26867691 ~ 26874040 (-) True XLOC_012148
TCONS_00023940 other downstream 493897 26716160 ~ 26720994 (-) True XLOC_012146
TCONS_00023928 other downstream 1350472 25864305 ~ 25864419 (-) True XLOC_012140
TCONS_00023915 other downstream 1626461 25587625 ~ 25588430 (-) True XLOC_012133
TCONS_00023977 other upstream 1295001 28530467 ~ 28530582 (-) True XLOC_012163
TCONS_00023979 other upstream 1388582 28624048 ~ 28624176 (-) True XLOC_012165
TCONS_00023990 other upstream 1574238 28809704 ~ 28811638 (-) True XLOC_012171
TCONS_00023997 other upstream 1980901 29216367 ~ 29224911 (-) True XLOC_012176
TCONS_00024000 other upstream 2037497 29272963 ~ 29273081 (-) True XLOC_012179

Expression Profile

//