RNA id: TCONS_00024093


Basic Information

Item Value
RNA id TCONS_00024093
length 551
RNA type processed_transcript
GC content 0.42
exon number 5
gene id XLOC_012226
representative False

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 32745763 ~ 32779556 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TGGCTGGAAAACTGTTACATCTTATCAAACACAAAAACAAGGTTTTGTTTGGCATGTTTGACACTTTGCAAGTTCTAACTTCTCTAACACCATTTTCTTGTTTTCCAGAAGCACCAAACAGAAAGGACGCCTTCAGAGAGAGTGCTGACGCTTCGAGAATTAGAAGCACATCTGGACAAGCTGGATAATGAGAAGAATGAGATGAACGATACAGACATTGCTGCGCTACACCACTTTTACTCTCGACATCTCGATTTTCCTGATAATGCAGCACTTACTGAACTTATCGCTCAGGTGAACTGTAATGGCTTCACCATTGAAGATGAAGAGCTGTCTCATTTGGGATCTGCTTTATTTCCAGACGTTGCTCTGATGAATCACAGCTGTAGCCCAAATGTGATTGTGACGTATAAGGGTACAGTGGCAGAAGTGAGAGCCGTGCAGGAGATCAACCCTGAAGAGGAGATCTTCAACAGTTATATTGACCTCCTATATCCAACAGAAGATAGAATTGAACGACTGAAAGACTCTTACTTCTTTAATTGTGACTG

Function

GO:

id name namespace
GO:0006325 chromatin organization biological_process
GO:0034968 histone lysine methylation biological_process
GO:0007507 heart development biological_process
GO:0007519 skeletal muscle tissue development biological_process
GO:0000122 negative regulation of transcription by RNA polymerase II biological_process
GO:0008285 negative regulation of cell population proliferation biological_process
GO:0018026 peptidyl-lysine monomethylation biological_process
GO:0018027 peptidyl-lysine dimethylation biological_process
GO:0033336 caudal fin development biological_process
GO:0060297 regulation of sarcomere organization biological_process
GO:0043516 regulation of DNA damage response, signal transduction by p53 class mediator biological_process
GO:0032259 methylation biological_process
GO:0060047 heart contraction biological_process
GO:0005829 cytosol cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0016740 transferase activity molecular_function
GO:0008168 methyltransferase activity molecular_function
GO:0046872 metal ion binding molecular_function
GO:0000993 RNA polymerase II complex binding molecular_function
GO:0046975 histone methyltransferase activity (H3-K36 specific) molecular_function
GO:0016279 protein-lysine N-methyltransferase activity molecular_function
GO:0018024 histone-lysine N-methyltransferase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050320-126 Predicted to enable RNA polymerase II complex binding activity and histone methyltransferase activity (H3-K36 specific). Acts upstream of or within several processes, including caudal fin development; heart contraction; and regulation of sarcomere organization. Predicted to be located in cytosol. Predicted to be active in nucleus. Is expressed in heart primordium; muscle cell; and somite. Orthologous to human SMYD2 (SET and MYND domain containing 2).

Ensembl:

ensembl_id ENSDART00000142356

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00024085 lncRNA downstream 114397 32631114 ~ 32635778 (-) True XLOC_012223
TCONS_00024079 lncRNA downstream 341776 32391056 ~ 32408399 (-) False XLOC_012221
TCONS_00024075 lncRNA downstream 381388 32367106 ~ 32368787 (-) True XLOC_012220
TCONS_00024935 lncRNA downstream 614047 32127897 ~ 32136128 (-) True XLOC_012218
TCONS_00024934 lncRNA downstream 614323 32127897 ~ 32135852 (-) False XLOC_012218
TCONS_00024094 lncRNA upstream 10059 32763343 ~ 32779442 (-) False XLOC_012226
TCONS_00024937 lncRNA upstream 380535 33133819 ~ 33138376 (-) True XLOC_012228
TCONS_00024938 lncRNA upstream 392310 33145594 ~ 33162478 (-) True XLOC_012229
TCONS_00024098 lncRNA upstream 453496 33206780 ~ 33231714 (-) False XLOC_012230
TCONS_00024541 lncRNA upstream 453670 33206954 ~ 33209500 (-) True XLOC_012230
TCONS_00024089 mRNA downstream 6926 32720413 ~ 32743249 (-) False XLOC_012225
TCONS_00024088 mRNA downstream 6926 32720413 ~ 32743249 (-) False XLOC_012225
TCONS_00024090 mRNA downstream 7131 32722165 ~ 32743044 (-) True XLOC_012225
TCONS_00024086 mRNA downstream 51658 32657202 ~ 32698517 (-) False XLOC_012224
TCONS_00024087 mRNA downstream 51672 32662042 ~ 32698503 (-) True XLOC_012224
TCONS_00024096 mRNA upstream 69304 32822588 ~ 32865788 (-) False XLOC_012227
TCONS_00024097 mRNA upstream 69313 32822597 ~ 32863250 (-) True XLOC_012227
TCONS_00024099 mRNA upstream 479464 33232748 ~ 33289304 (-) False XLOC_012231
TCONS_00024100 mRNA upstream 480378 33233662 ~ 33289349 (-) False XLOC_012231
TCONS_00024102 mRNA upstream 635615 33388899 ~ 33405301 (-) False XLOC_012232
TCONS_00024082 other downstream 324071 32423434 ~ 32426104 (-) True XLOC_012221
TCONS_00024076 other downstream 348487 32391056 ~ 32401688 (-) False XLOC_012221
TCONS_00024073 other downstream 503920 32246129 ~ 32246255 (-) True XLOC_012219
TCONS_00024057 other downstream 1365627 31384434 ~ 31384548 (-) True XLOC_012208
TCONS_00024055 other downstream 1389576 31352195 ~ 31360599 (-) False XLOC_012207
TCONS_00024095 other upstream 21633 32774917 ~ 32779442 (-) True XLOC_012226
TCONS_00024101 other upstream 485033 33238317 ~ 33239286 (-) True XLOC_012231
TCONS_00024113 other upstream 938414 33691698 ~ 33705464 (-) False XLOC_012236
TCONS_00024114 other upstream 946095 33699379 ~ 33713177 (-) False XLOC_012236
TCONS_00024124 other upstream 2475304 35228588 ~ 35238312 (-) True XLOC_012241

Expression Profile

//