RNA id: TCONS_00000208


Basic Information

Item Value
RNA id TCONS_00000208
length 338
RNA type processed_transcript
GC content 0.46
exon number 3
gene id XLOC_000113
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 9153141 ~ 9161843 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAATTGTTGTTCAAACGAACTGCGTCTAAACGTCGCTTTTGTCGTCAAATTTTAGTTCTCTCCTTGAATTGCACAAAAGGAGGAAGGCAGTGACTGAGCCTGAGGCCCGATACTTCATGCGCCAGACTATTCAGGGTGTTCAGTACTTGCACAACAACAGAGTCATTCACCGTGATCTCAAACTTGGGAATCTGTTCCTCAATGATGACATGGATGTGAAGATCGGTGACTTTGGTTTAGCCACTAAGATTGAGTTTGATGGGGAGCGAAAGAAGACCCTTTGTGGCACTCCAAACTACATTGCTCCTGAGGTGCTCTGCAAGAAAGGCCACAGCTTT

Function

GO:

id name namespace
GO:0006468 protein phosphorylation biological_process
GO:0032465 regulation of cytokinesis biological_process
GO:0016310 phosphorylation biological_process
GO:0060041 retina development in camera-type eye biological_process
GO:0000278 mitotic cell cycle biological_process
GO:0005813 centrosome cellular_component
GO:0000922 spindle pole cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0016740 transferase activity molecular_function
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function
GO:0016301 kinase activity molecular_function

KEGG:

id description
ko04068 FoxO signaling pathway
ko04110 Cell cycle
ko04114 Oocyte meiosis
ko04914 Progesterone-mediated oocyte maturation
ko01001 Protein kinases
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-021115-7 Predicted to enable protein serine/threonine kinase activity. Acts upstream of or within mitotic cell cycle and retina development in camera-type eye. Predicted to be located in midbody. Predicted to be active in cytoplasm; microtubule cytoskeleton; and nucleus. Is expressed in several structures, including immature eye; nervous system; neural tube; pharynx; and tail bud. Human ortholog(s) of this gene implicated in urinary bladder cancer. Orthologous to human PLK1 (polo like kinase 1).

Ensembl:

ensembl_id ENSDART00000139877

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003032 lncRNA upstream 21604 9129386 ~ 9132490 (+) True XLOC_000111
TCONS_00003031 lncRNA upstream 177672 8967479 ~ 8976422 (+) True XLOC_000106
TCONS_00003029 lncRNA upstream 188155 8950874 ~ 8965939 (+) False XLOC_000105
TCONS_00000198 lncRNA upstream 188155 8950874 ~ 8965939 (+) False XLOC_000105
TCONS_00003030 lncRNA upstream 188155 8961004 ~ 8965939 (+) True XLOC_000105
TCONS_00000210 lncRNA downstream 2103 9157376 ~ 9161475 (+) True XLOC_000113
TCONS_00000214 lncRNA downstream 122573 9277846 ~ 9285351 (+) True XLOC_000116
TCONS_00000220 lncRNA downstream 731682 9886955 ~ 9914630 (+) False XLOC_000120
TCONS_00002811 lncRNA downstream 791391 9946664 ~ 9951873 (+) True XLOC_000121
TCONS_00000233 lncRNA downstream 899135 10054408 ~ 10055303 (+) True XLOC_000126
TCONS_00000206 mRNA upstream 8198 9144958 ~ 9145896 (+) True XLOC_000112
TCONS_00000205 mRNA upstream 62159 9086942 ~ 9091935 (+) True XLOC_000110
TCONS_00000204 mRNA upstream 62435 9082417 ~ 9091659 (+) False XLOC_000110
TCONS_00000203 mRNA upstream 79615 9071324 ~ 9074479 (+) True XLOC_000109
TCONS_00000201 mRNA upstream 89182 9004719 ~ 9064912 (+) False XLOC_000108
TCONS_00000211 mRNA downstream 43758 9199031 ~ 9227204 (+) False XLOC_000114
TCONS_00000212 mRNA downstream 43876 9199149 ~ 9206616 (+) True XLOC_000114
TCONS_00000215 mRNA downstream 134830 9290103 ~ 9294115 (+) True XLOC_000117
TCONS_00000216 mRNA downstream 401939 9557212 ~ 9712302 (+) False XLOC_000118
TCONS_00000217 mRNA downstream 553528 9708801 ~ 9711245 (+) True XLOC_000118
TCONS_00000154 other upstream 2090151 7063837 ~ 7063943 (+) True XLOC_000081
TCONS_00000149 other upstream 2366290 6787690 ~ 6787804 (+) True XLOC_000078
TCONS_00000134 other upstream 2968562 6182342 ~ 6185532 (+) False XLOC_000067
TCONS_00000123 other upstream 3652010 5497285 ~ 5502084 (+) True XLOC_000062
TCONS_00000120 other upstream 3666932 5437390 ~ 5487162 (+) False XLOC_000062
TCONS_00000213 other downstream 63375 9218648 ~ 9221616 (+) True XLOC_000115
TCONS_00000230 other downstream 896501 10051774 ~ 10054771 (+) False XLOC_000126
TCONS_00000231 other downstream 896511 10051784 ~ 10058057 (+) False XLOC_000126
TCONS_00000232 other downstream 898746 10054019 ~ 10057808 (+) False XLOC_000126
TCONS_00000236 other downstream 927205 10082478 ~ 10087525 (+) False XLOC_000127

Expression Profile

//