RNA id: TCONS_00026417


Basic Information

Item Value
RNA id TCONS_00026417
length 498
RNA type mRNA
GC content 0.42
exon number 6
gene id XLOC_013365
representative True

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 18870625 ~ 18875308 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGCAGAGCTTGGATGAAGAGGACTTTTCTGTTTCAAAATCATCAGATGCTGATGCAGAATTTGACATAGTAATTGGGAACATCGAGGACATTATAATGGAGGATGAGTTCCAGCATCTTCAACAGTCTTTTATGGAGAAATATTACCTTGAGTTTGATGACTCAGAGGAGAACAAGCTCAGCTATACACCCATTTTTAACGAATATATTGAAATCCTAGAGAAGCATCTGGAACAGCAGTTGGTGGAACGAATTCCTGGGTTCAACATGGATGCCTTCACCCATTCACTTAAACAGCACAAAGATGAGGTCTCAGGTGACATACTTGACATGCTGCTTACTTTCACTGATTTTATGGCCTTTAAAGAGATGTTCACTGACTACAGAGCTGAAAAGGAGGGCAGAGGATTGGATCTTAGCACCGGACTAGTGGTAAAGTCTTTAAATTCTTCCTCGGCTTCACCTTTGACCCCCAGCATGGCCTCACAGTCCATCTGA

Function

GO:

id name namespace
GO:0051457 maintenance of protein location in nucleus biological_process
GO:0042531 positive regulation of tyrosine phosphorylation of STAT protein biological_process
GO:0005758 mitochondrial intermembrane space cellular_component
GO:0042995 cell projection cellular_component
GO:0005815 microtubule organizing center cellular_component
GO:0005819 spindle cellular_component
GO:0005856 cytoskeleton cellular_component
GO:0005634 nucleus cellular_component
GO:0005929 cilium cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005739 mitochondrion cellular_component

KEGG:

id description
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-040426-1604 Predicted to be involved in maintenance of protein location in nucleus and positive regulation of tyrosine phosphorylation of STAT protein. Predicted to be located in several cellular components, including cilium; microtubule cytoskeleton; and mitochondrion. Predicted to be active in mitochondrial intermembrane space. Human ortholog(s) of this gene implicated in retinitis pigmentosa with or without situs inversus. Orthologous to human ARL2BP (ADP ribosylation factor like GTPase 2 binding protein).

Ensembl:

ensembl_id ENSDART00000193332

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00027291 lncRNA downstream 50033 18815654 ~ 18821370 (-) False XLOC_013359
TCONS_00027290 lncRNA downstream 78138 18787384 ~ 18793265 (-) False XLOC_013363
TCONS_00027289 lncRNA downstream 121998 18744462 ~ 18749405 (-) False XLOC_013362
TCONS_00027288 lncRNA downstream 144371 18713973 ~ 18727032 (-) False XLOC_013361
TCONS_00026960 lncRNA upstream 1469 18876390 ~ 18878724 (-) True XLOC_013366
TCONS_00027292 lncRNA upstream 235126 19110047 ~ 19111916 (-) True XLOC_013371
TCONS_00026439 lncRNA upstream 577693 19452614 ~ 19453739 (-) False XLOC_013375
TCONS_00026441 lncRNA upstream 579233 19454154 ~ 19456200 (-) False XLOC_013375
TCONS_00027293 lncRNA upstream 1008670 19883591 ~ 19884294 (-) True XLOC_013386
TCONS_00026413 mRNA downstream 21101 18803539 ~ 18850302 (-) False XLOC_013364
TCONS_00026412 mRNA downstream 21101 18803539 ~ 18850302 (-) False XLOC_013364
TCONS_00026415 mRNA downstream 21487 18832226 ~ 18849916 (-) True XLOC_013364
TCONS_00026406 mRNA downstream 49474 18636901 ~ 18821929 (-) False XLOC_013359
TCONS_00026404 mRNA downstream 203987 18636273 ~ 18667416 (-) False XLOC_013359
TCONS_00026418 mRNA upstream 56563 18931484 ~ 18942098 (-) False XLOC_013367
TCONS_00026419 mRNA upstream 60160 18935081 ~ 18937485 (-) True XLOC_013367
TCONS_00026420 mRNA upstream 100618 18975539 ~ 18979520 (-) True XLOC_013368
TCONS_00026422 mRNA upstream 120326 18995247 ~ 19004247 (-) False XLOC_013369
TCONS_00026423 mRNA upstream 120326 18995247 ~ 19005919 (-) False XLOC_013369
TCONS_00026414 other downstream 50033 18815654 ~ 18821370 (-) True XLOC_013359
TCONS_00026411 other downstream 78138 18787384 ~ 18793265 (-) True XLOC_013363
TCONS_00026410 other downstream 121998 18744462 ~ 18749405 (-) True XLOC_013362
TCONS_00026408 other downstream 169639 18696207 ~ 18701764 (-) True XLOC_013360
TCONS_00026403 other downstream 293509 18577814 ~ 18577894 (-) True XLOC_013357
TCONS_00026421 other upstream 120326 18995247 ~ 18999255 (-) False XLOC_013369
TCONS_00026429 other upstream 235126 19110047 ~ 19111751 (-) False XLOC_013371
TCONS_00026433 other upstream 499918 19374839 ~ 19374955 (-) True XLOC_013373
TCONS_00026434 other upstream 548090 19423011 ~ 19423128 (-) True XLOC_013374
TCONS_00026436 other upstream 576661 19451582 ~ 19451651 (-) True XLOC_013376

Expression Profile

//