RNA id: TU37660



Basic Information


Item Value
RNA id TU37660
length 235
lncRNA type inter_gene
GC content 0.48
exon number 1
gene id G33247
representative True

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 31848741 ~ 31848975 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aaagtagccaccttttgccttgatgacagctttgcactctcttggcattctctcaaccagcttcacctggaatgcttttccaacagtcttgaaggaatcccatatatgctgagcacttgttggctgcttttccttcactctgcggtccaactcatcccaaaccatctcaattgggttgaggtcaggtgattgtggaggccaggttatctgatgcagcactccatcactctccttc

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU37158 lncRNA upstream 16109 31832209 ~ 31832632 (+) True G32774
TU37131 lncRNA upstream 49710 31798384 ~ 31799031 (+) True G32748
TU37130 lncRNA upstream 50552 31797911 ~ 31798189 (+) True G32747
TU37062 lncRNA upstream 156580 31691899 ~ 31692161 (+) True G32680
TU37008 lncRNA upstream 233519 31612869 ~ 31615222 (+) True G32639
TU37664 lncRNA downstream 2244 31851219 ~ 31851475 (+) True G33251
TU37671 lncRNA downstream 7397 31856372 ~ 31856678 (+) True G33258
TU37748 lncRNA downstream 119088 31968063 ~ 31968385 (+) True G33334
TU37850 lncRNA downstream 153415 32002390 ~ 32002823 (+) True G33432
TU38003 lncRNA downstream 359948 32208923 ~ 32209125 (+) True G33576
XM_021598657.2 mRNA upstream 66546 31668656 ~ 31782195 (+) False LOC110521218
XM_021598665.2 mRNA upstream 66546 31668656 ~ 31782195 (+) False LOC110521218
XM_036975692.1 mRNA upstream 66546 31729095 ~ 31782195 (+) True LOC110521218
trnah-gug mRNA upstream 181166 31667504 ~ 31667575 (+) True trnah-gug
XM_021598646.2 mRNA upstream 186594 31639629 ~ 31662147 (+) True LOC110521202
XM_021597495.2 mRNA downstream 115589 31964564 ~ 31966876 (+) True LOC110520271
XM_021598719.2 mRNA downstream 131310 31980285 ~ 31989249 (+) True LOC110521263
XM_021598789.2 mRNA downstream 250234 32099209 ~ 32199761 (+) False LOC110521304
XM_021598780.2 mRNA downstream 266645 32115620 ~ 32204312 (+) True LOC110521304
XM_021598800.2 mRNA downstream 355500 32204475 ~ 32215553 (+) True zgc:162879
TU34064 other upstream 2595523 29192729 ~ 29253218 (+) False mef2aa
TU33696 other upstream 2780946 29065656 ~ 29067795 (+) True LOC110520661
TU32543 other upstream 3800379 28047626 ~ 28048362 (+) True G28416
TU32398 other upstream 3993787 27853757 ~ 27854954 (+) True G28285
TU32393 other upstream 4003730 27844640 ~ 27845011 (+) True G28280
TU37662 other downstream 1498 31850473 ~ 31850969 (+) True G33249
TU37697 other downstream 107555 31956530 ~ 31961547 (+) True G33284
TU38120 other downstream 601879 32450854 ~ 32452385 (+) True G33681
TU38224 other downstream 764098 32613073 ~ 32617316 (+) False G33768
TU38223 other downstream 764787 32613762 ~ 32617684 (+) True G33768

Expression Profile


TU37660 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU37660 Expression in each Bioproject

Bar chart with 21 bars.
TU37660 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.