RNA id: TU37697



Basic Information


Item Value
RNA id TU37697
length 363
RNA type TUCP
GC content 0.51
exon number 2
gene id G33284
representative True

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 31956530 ~ 31961547 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gtgaatgaggacccaaaagcgacttaacgtaaacagagcttctttaatagcaaaacaaacgtaggctcagatggaccggcagattccgacaggacaggacaaggttgcagcaaacatgacgatagtctggttcaggcatgaacaacacaaacaagaatccgacaaagacaggagcagaaacagagagagatatagaggactaatcagagggaaaaagggaacaggtgggaaaaggggtaacgaggtagttaggaggagacaaggcacagctggggaaaagagggggagaaaaggtaacctaacacgaccagcagagggagacagggtgaaaggaaaggacagaaacaagacacaacatgacaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU37671 lncRNA upstream 99852 31856372 ~ 31856678 (+) True G33258
TU37664 lncRNA upstream 105055 31851219 ~ 31851475 (+) True G33251
TU37660 lncRNA upstream 107555 31848741 ~ 31848975 (+) True G33247
TU37158 lncRNA upstream 123898 31832209 ~ 31832632 (+) True G32774
TU37131 lncRNA upstream 157499 31798384 ~ 31799031 (+) True G32748
TU37748 lncRNA downstream 6516 31968063 ~ 31968385 (+) True G33334
TU37850 lncRNA downstream 40843 32002390 ~ 32002823 (+) True G33432
TU38003 lncRNA downstream 247376 32208923 ~ 32209125 (+) True G33576
TU37898 lncRNA downstream 255603 32217150 ~ 32217924 (+) True G33474
TU37908 lncRNA downstream 257902 32219449 ~ 32225528 (+) True G33484
XM_021598657.2 mRNA upstream 174335 31668656 ~ 31782195 (+) False LOC110521218
XM_021598665.2 mRNA upstream 174335 31668656 ~ 31782195 (+) False LOC110521218
XM_036975692.1 mRNA upstream 174335 31729095 ~ 31782195 (+) True LOC110521218
trnah-gug mRNA upstream 288955 31667504 ~ 31667575 (+) True trnah-gug
XM_021598646.2 mRNA upstream 294383 31639629 ~ 31662147 (+) True LOC110521202
XM_021597495.2 mRNA downstream 3017 31964564 ~ 31966876 (+) True LOC110520271
XM_021598719.2 mRNA downstream 18738 31980285 ~ 31989249 (+) True LOC110521263
XM_021598789.2 mRNA downstream 137662 32099209 ~ 32199761 (+) False LOC110521304
XM_021598780.2 mRNA downstream 154073 32115620 ~ 32204312 (+) True LOC110521304
XM_021598800.2 mRNA downstream 242928 32204475 ~ 32215553 (+) True zgc:162879
TU37662 other upstream 105561 31850473 ~ 31850969 (+) True G33249
TU34064 other upstream 2703312 29192729 ~ 29253218 (+) False mef2aa
TU33696 other upstream 2888735 29065656 ~ 29067795 (+) True LOC110520661
TU32543 other upstream 3908168 28047626 ~ 28048362 (+) True G28416
TU32398 other upstream 4101576 27853757 ~ 27854954 (+) True G28285
TU38120 other downstream 489307 32450854 ~ 32452385 (+) True G33681
TU38224 other downstream 651526 32613073 ~ 32617316 (+) False G33768
TU38223 other downstream 652215 32613762 ~ 32617684 (+) True G33768
TU39239 other downstream 1361220 33322767 ~ 33323605 (+) True sema3e
TU39330 other downstream 1430176 33391723 ~ 33398659 (+) False LOC118964465

Expression Profile


TU37697 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU37697 Expression in each Bioproject

Bar chart with 19 bars.
TU37697 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.