RNA id: TCONS_00026598


Basic Information

Item Value
RNA id TCONS_00026598
length 386
RNA type processed_transcript
GC content 0.43
exon number 3
gene id XLOC_013486
representative True

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 29885190 ~ 29898369 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGCAACATAGGAAGGCACCATGCTAAATGTGATTTGATGCCTAGGTGAATTGCGGCTTTAGGGTTATTGCATTGCATCGCATCAAAAACCTGACGTCTGTGTGAGAACATGAAATATAAAGCAAAGGAGCTGACTAACATAACATACATTTCTGATTTGTTGTTAGTGTGTATTAGCCACTGTGGACTTTAAACACGTGAACTGTGATGCCCTTCAGGAGTTTTACACAACTGAACCGCCTATAAGGCTATTGGTAAGTGTTGCAGATTTCAGAGGATTTTAGAATGAGTGATGGTTTGGGATGGGGCGGCTGATGCATCCGGATCTGTCGCCCCATCTGCATACTGATGAGTGCAATCAGCTTATAACACTTCTCAAACAGTGCC

Function

GO:

id name namespace
GO:0005739 mitochondrion cellular_component

KEGG:

id description
ko03029 Mitochondrial biogenesis

ZFIN:

id description
ZDB-GENE-030616-409 Predicted to be active in mitochondrion. Orthologous to human CMC2 (C-X9-C motif containing 2).

Ensembl:

ensembl_id ENSDART00000134751

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00027355 lncRNA downstream 492595 29397940 ~ 29403016 (-) True XLOC_013485
TCONS_00027354 lncRNA downstream 1292496 28601593 ~ 28603115 (-) True XLOC_013479
TCONS_00026589 lncRNA downstream 1571825 28320730 ~ 28323786 (-) False XLOC_013478
TCONS_00027353 lncRNA downstream 1673863 28204344 ~ 28221748 (-) True XLOC_013477
TCONS_00026972 lncRNA downstream 2075705 27818134 ~ 27819906 (-) True XLOC_013475
TCONS_00027356 lncRNA upstream 854123 30752484 ~ 30753423 (-) True XLOC_013493
TCONS_00027357 lncRNA upstream 1061811 30960172 ~ 30961069 (-) True XLOC_013495
TCONS_00026613 lncRNA upstream 1151128 31049489 ~ 31051597 (-) True XLOC_013496
TCONS_00026973 lncRNA upstream 1825745 31724106 ~ 31724812 (-) True XLOC_013500
TCONS_00026974 lncRNA upstream 1834262 31732623 ~ 31737816 (-) True XLOC_013501
TCONS_00026591 mRNA downstream 956699 28937061 ~ 28938912 (-) True XLOC_013481
TCONS_00026587 mRNA downstream 1998394 27843840 ~ 27897217 (-) True XLOC_013476
TCONS_00026586 mRNA downstream 2037488 27843776 ~ 27858123 (-) False XLOC_013476
TCONS_00026585 mRNA downstream 2266827 27590442 ~ 27628784 (-) True XLOC_013473
TCONS_00026583 mRNA downstream 2579012 27309404 ~ 27316599 (-) True XLOC_013470
TCONS_00026600 mRNA upstream 24578 29922939 ~ 29925717 (-) True XLOC_013488
TCONS_00026601 mRNA upstream 60292 29958653 ~ 29961818 (-) False XLOC_013489
TCONS_00026602 mRNA upstream 60696 29959057 ~ 29962234 (-) False XLOC_013489
TCONS_00026603 mRNA upstream 60763 29959124 ~ 29961784 (-) True XLOC_013489
TCONS_00026604 mRNA upstream 69844 29968205 ~ 30020879 (-) False XLOC_013490
TCONS_00026594 other downstream 587970 29307525 ~ 29307641 (-) True XLOC_013484
TCONS_00026593 other downstream 682362 29213133 ~ 29213249 (-) True XLOC_013483
TCONS_00026592 other downstream 810437 29085058 ~ 29085174 (-) True XLOC_013482
TCONS_00026590 other downstream 1099936 28795559 ~ 28795675 (-) True XLOC_013480
TCONS_00026588 other downstream 1571456 28320730 ~ 28324155 (-) True XLOC_013478
TCONS_00026599 other upstream 19701 29918062 ~ 29919105 (-) True XLOC_013487
TCONS_00026611 other upstream 956135 30854496 ~ 30855535 (-) True XLOC_013494
TCONS_00026625 other upstream 2627050 32525411 ~ 32527104 (-) True XLOC_013509
TCONS_00026632 other upstream 3192082 33090443 ~ 33093741 (-) False XLOC_013517
TCONS_00026656 other upstream 5674820 35573181 ~ 35573295 (-) True XLOC_013536

Expression Profile

//