RNA id: TCONS_00026613


Basic Information

Item Value
RNA id TCONS_00026613
length 410
lncRNA type retained_intron
GC content 0.41
exon number 2
gene id XLOC_013496
representative True

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 31033122 ~ 31051847 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAGCCAAAATGTGTTATAATGTGTTAACGTTAATTGCAAATGGTAACTTAGTTAATCTACCAAATCTAACGTATTTCTTATCGTTTATTGACTAGCAACATTACATTCTAACGATACTGTGCTGTTTGTAATAGATGCAGAGATCTCATCTTGATCGAATGTAACGTTAGCCTGTTTAGCGTTAACTTATCACTTCATATTTCAGCCACCAAAAAGAAAATCGTCGCCGAAGGGCAAAACTCCAACAGTAGTGGACGGCTTGTCCACAGAGGAGATGTCAAAAGAGCAGTTGGAGGAGCACATAATGCGTCTCCGAGAGGAGCTGGACAGGGAGAGAGAAGAACGCAACTATTTCCAGCTAGAGAGGGACAAAATTCACACTTTCTGGGAAATTACACGACGACATCTCG

Function

GO:

id name namespace
GO:0003355 cilium movement involved in otolith formation biological_process
GO:0055001 muscle cell development biological_process
GO:0035082 axoneme assembly biological_process
GO:0035889 otolith tethering biological_process
GO:0048870 cell motility biological_process
GO:0045880 positive regulation of smoothened signaling pathway biological_process
GO:0034613 cellular protein localization biological_process
GO:1903566 positive regulation of protein localization to cilium biological_process
GO:0030317 flagellated sperm motility biological_process
GO:0031514 motile cilium cellular_component
GO:0042995 cell projection cellular_component
GO:0036064 ciliary basal body cellular_component
GO:0005794 Golgi apparatus cellular_component
GO:0005856 cytoskeleton cellular_component
GO:0005874 microtubule cellular_component
GO:0005929 cilium cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008017 microtubule binding molecular_function

KEGG:

id description
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-030131-1980 Predicted to enable microtubule binding activity. Involved in cilium movement involved in otolith formation and otolith tethering. Acts upstream of or within muscle cell development and positive regulation of smoothened signaling pathway. Predicted to be located in ciliary basal body and cytoplasm. Predicted to be active in Golgi apparatus and microtubule. Is expressed in neural tube; otic placode; otic vesicle; and pronephric duct. Human ortholog(s) of this gene implicated in primary ciliary dyskinesia 33. Orthologous to human GAS8 (growth arrest specific 8).

Ensembl:

ensembl_id ENSDART00000165126

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00027357 lncRNA downstream 88420 30960172 ~ 30961069 (-) True XLOC_013495
TCONS_00027356 lncRNA downstream 296066 30752484 ~ 30753423 (-) True XLOC_013493
TCONS_00027355 lncRNA downstream 1646473 29397940 ~ 29403016 (-) True XLOC_013485
TCONS_00027354 lncRNA downstream 2446374 28601593 ~ 28603115 (-) True XLOC_013479
TCONS_00026589 lncRNA downstream 2725703 28320730 ~ 28323786 (-) False XLOC_013478
TCONS_00026973 lncRNA upstream 672509 31724106 ~ 31724812 (-) True XLOC_013500
TCONS_00026974 lncRNA upstream 681026 31732623 ~ 31737816 (-) True XLOC_013501
TCONS_00026619 lncRNA upstream 953461 32005058 ~ 32008314 (-) False XLOC_013504
TCONS_00027359 lncRNA upstream 953461 32005058 ~ 32008862 (-) False XLOC_013504
TCONS_00027358 lncRNA upstream 953461 32005058 ~ 32008862 (-) False XLOC_013504
TCONS_00026609 mRNA downstream 544837 30500690 ~ 30504652 (-) False XLOC_013492
TCONS_00026610 mRNA downstream 544902 30501720 ~ 30504587 (-) True XLOC_013492
TCONS_00026608 mRNA downstream 550000 30481030 ~ 30499489 (-) True XLOC_013491
TCONS_00026605 mRNA downstream 1028010 29969732 ~ 30021479 (-) False XLOC_013490
TCONS_00026614 mRNA upstream 38360 31089957 ~ 31105391 (-) True XLOC_013497
TCONS_00026615 mRNA upstream 174691 31226288 ~ 31227615 (-) True XLOC_013498
TCONS_00026616 mRNA upstream 247479 31299076 ~ 31423569 (-) True XLOC_013499
TCONS_00026617 mRNA upstream 861162 31912759 ~ 31916845 (-) True XLOC_013502
TCONS_00026618 mRNA upstream 913750 31965347 ~ 31969939 (-) True XLOC_013503
TCONS_00026611 other downstream 193954 30854496 ~ 30855535 (-) True XLOC_013494
TCONS_00026599 other downstream 1130384 29918062 ~ 29919105 (-) True XLOC_013487
TCONS_00026598 other downstream 1151128 29895611 ~ 29898361 (-) True XLOC_013486
TCONS_00026594 other downstream 1741848 29307525 ~ 29307641 (-) True XLOC_013484
TCONS_00026593 other downstream 1836240 29213133 ~ 29213249 (-) True XLOC_013483
TCONS_00026625 other upstream 1473814 32525411 ~ 32527104 (-) True XLOC_013509
TCONS_00026632 other upstream 2038846 33090443 ~ 33093741 (-) False XLOC_013517
TCONS_00026656 other upstream 4521584 35573181 ~ 35573295 (-) True XLOC_013536
TCONS_00026662 other upstream 5403710 36455307 ~ 36465466 (-) True XLOC_013541
TCONS_00026673 other upstream 6358226 37409823 ~ 37415353 (-) False XLOC_013550