RNA id: TCONS_00026622


Basic Information

Item Value
RNA id TCONS_00026622
length 392
lncRNA type lincRNA
GC content 0.44
exon number 2
gene id XLOC_013504
representative True

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 32005058 ~ 32009056 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ttctcactcccaactcgtcatatactgacgcttggtcaggaaccctcggcgtaggttattgacgcacagggtacccctttagcgtcatatttagacgtgcagggattccctatagaatatgtacctgagcctgaggcgtcatagggagacgctggaggctcgtataattaccaatagatgtcaacgcaatttttaaaacctgatttacgcctattatcgcagttttcttattttaaaaatatgtcatttttattttgttcatgaaaagcgtctgtaaactgggtcgaaactactgtatgaataaacttcggtccacgtgacatcccttcacgtctatggtcgcgatcccaaggttcattgcgatcccaaggttcactgcggttttccacaag

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010468 regulation of gene expression biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0003002 regionalization biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDART00000141041

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00026620 lncRNA downstream 944 32005382 ~ 32007357 (-) False XLOC_013504
TCONS_00026974 lncRNA downstream 270485 31732623 ~ 31737816 (-) True XLOC_013501
TCONS_00026973 lncRNA downstream 283489 31724106 ~ 31724812 (-) True XLOC_013500
TCONS_00026613 lncRNA downstream 956704 31049489 ~ 31051597 (-) True XLOC_013496
TCONS_00027357 lncRNA downstream 1047232 30960172 ~ 30961069 (-) True XLOC_013495
TCONS_00026975 lncRNA upstream 30445 32039501 ~ 32042362 (-) True XLOC_013505
TCONS_00026624 lncRNA upstream 137652 32146708 ~ 32147630 (-) True XLOC_013507
TCONS_00027361 lncRNA upstream 299420 32308476 ~ 32309563 (-) True XLOC_013508
TCONS_00027362 lncRNA upstream 773557 32782613 ~ 32814481 (-) False XLOC_013511
TCONS_00027363 lncRNA upstream 796728 32805784 ~ 32814560 (-) False XLOC_013511
TCONS_00026618 mRNA downstream 38362 31965347 ~ 31969939 (-) True XLOC_013503
TCONS_00026617 mRNA downstream 91456 31912759 ~ 31916845 (-) True XLOC_013502
TCONS_00026616 mRNA downstream 584732 31299076 ~ 31423569 (-) True XLOC_013499
TCONS_00026615 mRNA downstream 780686 31226288 ~ 31227615 (-) True XLOC_013498
TCONS_00026614 mRNA downstream 902910 31089957 ~ 31105391 (-) True XLOC_013497
TCONS_00026623 mRNA upstream 126314 32135370 ~ 32139894 (-) True XLOC_013506
TCONS_00026626 mRNA upstream 665156 32674212 ~ 32677755 (-) False XLOC_013510
TCONS_00026627 mRNA upstream 665180 32674236 ~ 32709328 (-) False XLOC_013510
TCONS_00026628 mRNA upstream 696409 32705465 ~ 32709297 (-) True XLOC_013510
TCONS_00026630 mRNA upstream 1065662 33074718 ~ 33080454 (-) True XLOC_013515
TCONS_00026611 other downstream 1152766 30854496 ~ 30855535 (-) True XLOC_013494
TCONS_00026599 other downstream 2089196 29918062 ~ 29919105 (-) True XLOC_013487
TCONS_00026598 other downstream 2109940 29895611 ~ 29898361 (-) True XLOC_013486
TCONS_00026594 other downstream 2700660 29307525 ~ 29307641 (-) True XLOC_013484
TCONS_00026593 other downstream 2795052 29213133 ~ 29213249 (-) True XLOC_013483
TCONS_00026625 other upstream 516355 32525411 ~ 32527104 (-) True XLOC_013509
TCONS_00026632 other upstream 1081387 33090443 ~ 33093741 (-) False XLOC_013517
TCONS_00026656 other upstream 3564125 35573181 ~ 35573295 (-) True XLOC_013536
TCONS_00026662 other upstream 4446251 36455307 ~ 36465466 (-) True XLOC_013541
TCONS_00026673 other upstream 5400767 37409823 ~ 37415353 (-) False XLOC_013550

Expression Profile

//