RNA id: TU82901



Basic Information


Item Value
RNA id TU82901
length 371
lncRNA type antisense_over
GC content 0.56
exon number 2
gene id G75004
representative True

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 67800175 ~ 67800581 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGCACAATGCAGGCTGTGCTGACCACCTTGGGTGGAGGAGGGCCCACAGGGATCTGGATAGAGCTTTGCTGCATGGGAGGAGGCTGCTGCATGGGATGTCGCTGCATAGGCGGGGCCTGGTGCATGGGGGGCCCCTGGTACATGGGTGGTCCCTGGTGCATTGGAGGCCCTTGGTACATGGGAGGTCCCTGCTGCATGGAAGGTCCCTTCTGAATACAAAGCCCCTGGTACATGGATTGCCCCTGGTACATGGGAGGGGCTTTTTGCATGGGGGGAGCCTGGCCATATAGGCTGCAGAAGGATAAAAAAGAAGCTGAGTGACATCATCACCACCTAAATTCAAACATATCTCTACTAGTCTTATTACTTCA

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU82853 lncRNA upstream 4812 67793781 ~ 67795363 (+) True G74956
TU82842 lncRNA upstream 97238 67699969 ~ 67702937 (+) True G74945
TU82673 lncRNA upstream 128621 67669671 ~ 67671554 (+) True G74790
TU82774 lncRNA upstream 203583 67596369 ~ 67596592 (+) True G74880
TU82773 lncRNA upstream 204288 67595523 ~ 67595887 (+) True G74879
TU82936 lncRNA downstream 62990 67863571 ~ 67871124 (+) True G75034
TU83012 lncRNA downstream 226055 68026636 ~ 68042452 (+) False G75107
TU83013 lncRNA downstream 230703 68031284 ~ 68042452 (+) True G75107
TU83071 lncRNA downstream 272090 68072671 ~ 68076067 (+) True G75151
TU83027 lncRNA downstream 277493 68078074 ~ 68079488 (+) True G75117
XM_021609153.2 mRNA upstream 75815 67705791 ~ 67724360 (+) True mmrn2a
XR_005037742.1 mRNA upstream 161755 67596677 ~ 67638420 (+) False glud1
NM_001172529.1 mRNA upstream 163060 67596711 ~ 67637115 (+) True glud1
XM_021609023.2 mRNA upstream 225126 67528611 ~ 67575049 (+) False psda
XR_005052605.1 mRNA downstream 315547 68116128 ~ 68117384 (+) True LOC118965297
XM_021609303.2 mRNA downstream 327284 68127865 ~ 68140839 (+) False LOC110527784
XM_021609293.2 mRNA downstream 327293 68127874 ~ 68140839 (+) True LOC110527784
XM_036983557.1 mRNA downstream 474798 68275379 ~ 68295406 (+) False slc2a15a
XM_036983560.1 mRNA downstream 474799 68275380 ~ 68295406 (+) True slc2a15a
TU81938 other upstream 1015206 66784335 ~ 66784969 (+) True G74139
TU81852 other upstream 1041191 66756207 ~ 66758984 (+) True G74067
TU81346 other upstream 1376094 66420495 ~ 66424081 (+) True LOC118965274
TU81252 other upstream 1511706 66287679 ~ 66288469 (+) True G73515
TU80729 other upstream 1877890 65915735 ~ 65922285 (+) True LOC110527164
TU83729 other downstream 573924 68374505 ~ 68374929 (+) True G75747
TU86384 other downstream 2771084 70571665 ~ 70654961 (+) True G78121
TU87354 other downstream 3235889 71036470 ~ 71076102 (+) True ccdc85a
TU90667 other downstream 5751035 73551616 ~ 73571737 (+) False G82111
TU90669 other downstream 5770485 73571066 ~ 73571737 (+) True G82111

Expression Profile


TU82901 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU82901 Expression in each Bioproject

Bar chart with 5 bars.
TU82901 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.