RNA id: TU86119



Basic Information


Item Value
RNA id TU86119
length 205
lncRNA type intronic
GC content 0.40
exon number 1
gene id G77895
representative True

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 70068453 ~ 70068657 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTACAAGACCCTAGCCTGAGATTTGTCTCCAAACACGGACAAAGCATACAAAACAACTGATTTGACATTGCTGTTATATTTGCATTTGTTTTGAGGCTGAATTGATTAGATCTCCAGATGGGAGGAGTTGGGCATATGCACAATGTAAGGTTTTTGGTTAAGTTTAGAGATCTTCCATCTGGGAAAACAGGGTCCACTGAATATC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU86114 lncRNA upstream 5571 70060219 ~ 70062882 (+) True G77891
TU86109 lncRNA upstream 11930 70054553 ~ 70056523 (+) False G77890
TU86103 lncRNA upstream 12840 70054553 ~ 70055613 (+) False G77890
TU86104 lncRNA upstream 12840 70055025 ~ 70055613 (+) True G77890
TU86100 lncRNA upstream 18134 70050049 ~ 70050319 (+) True G77888
TU86120 lncRNA downstream 1833 70070490 ~ 70070712 (+) True G77896
TU86122 lncRNA downstream 4013 70072670 ~ 70072874 (+) True G77898
TU86126 lncRNA downstream 13523 70082180 ~ 70095616 (+) True G77902
TU86127 lncRNA downstream 14180 70082837 ~ 70097099 (+) False G77903
TU86128 lncRNA downstream 14180 70082837 ~ 70097099 (+) True G77903
XM_021610425.2 mRNA upstream 15536 70051483 ~ 70052917 (+) False zgc:153981
XM_021610434.2 mRNA upstream 15536 70051548 ~ 70052917 (+) True zgc:153981
XM_021610378.2 mRNA upstream 68956 69990307 ~ 69999497 (+) False nvl
XM_036989830.1 mRNA downstream 53355 70122012 ~ 70122911 (+) True LOC118966712
XM_021610459.2 mRNA downstream 68173 70136830 ~ 70143694 (+) False chchd1
XM_036984226.1 mRNA downstream 94534 70163191 ~ 70188938 (+) False LOC110528418
XM_021610554.2 mRNA downstream 125638 70194295 ~ 70228504 (+) False zswim8
XM_021610519.2 mRNA downstream 125639 70194296 ~ 70228504 (+) False zswim8
TU83729 other upstream 1693524 68374505 ~ 68374929 (+) True G75747
TU81938 other upstream 3283484 66784335 ~ 66784969 (+) True G74139
TU81852 other upstream 3309469 66756207 ~ 66758984 (+) True G74067
TU81346 other upstream 3644372 66420495 ~ 66424081 (+) True LOC118965274
TU81252 other upstream 3779984 66287679 ~ 66288469 (+) True G73515
TU86384 other downstream 503008 70571665 ~ 70654961 (+) True G78121
TU87354 other downstream 967813 71036470 ~ 71076102 (+) True ccdc85a
TU90667 other downstream 3482959 73551616 ~ 73571737 (+) False G82111
TU90669 other downstream 3502409 73571066 ~ 73571737 (+) True G82111
TU92487 other downstream 4840568 74909225 ~ 74909806 (+) True G83836

Expression Profile


TU86119 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU86119 Expression in each Bioproject

Bar chart with 3 bars.
TU86119 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.