RNA id: TU131680



Basic Information


Item Value
RNA id TU131680
length 456
lncRNA type antisense_over
GC content 0.36
exon number 2
gene id G114717
representative True

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 13441854 ~ 13473747 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tgagaccctggccacccaagtctccaacctcacagaacaggttcaccatctccgccggccacttccagggctttcgaatctccggagcccagaatcaataacccgccgtgttactctggggagcccactgaatgccgctcgttcctcacccagtgtgatattgtgttttctctccagcccaacacttactccaggagcactgctcgtatcgcctacgtcatatctctccttactggacgggctcgtgagtggggcacggcaatctgggaggcaagggctgagtgtactaaccagtatcaggactttaaggaggagatgatacgggtttttgatcgatctgtttttggggaggaagcttccagggtcctgtcttccctatgtcaaggtaatcgatccataacagactactctattgagtttcgcactcttgctgcctccagtgactggaacgagccg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU131675 lncRNA upstream 10148 13429701 ~ 13431706 (+) True G114712
TU131651 lncRNA upstream 97671 13339715 ~ 13344183 (+) False G114689
TU131652 lncRNA upstream 101562 13338964 ~ 13340292 (+) False G114689
TU131650 lncRNA upstream 101562 13339561 ~ 13340292 (+) False G114689
TU131649 lncRNA upstream 101562 13339758 ~ 13340292 (+) True G114689
TU131887 lncRNA downstream 209949 13683696 ~ 13684785 (+) True G114897
TU131898 lncRNA downstream 244485 13718232 ~ 13718727 (+) True G114904
TU132023 lncRNA downstream 260981 13734728 ~ 13734956 (+) True G114990
TU132038 lncRNA downstream 281177 13754924 ~ 13756558 (+) True LOC110520780
TU132048 lncRNA downstream 288076 13761823 ~ 13762180 (+) True G115009
XM_021587748.2 mRNA upstream 53933 13383188 ~ 13387921 (+) True LOC110507631
XM_036938394.1 mRNA upstream 111178 13324961 ~ 13330676 (+) False LOC110507612
XM_036938495.1 mRNA downstream 100750 13574497 ~ 13582605 (+) True LOC110517609
XM_036938484.1 mRNA downstream 110377 13584124 ~ 13601598 (+) False LOC110507693
XM_036938477.1 mRNA downstream 110388 13584135 ~ 13604148 (+) True LOC110507693
XM_036938470.1 mRNA downstream 130557 13604304 ~ 13623972 (+) False LOC110520769
XM_036938524.1 mRNA downstream 150886 13624633 ~ 13630579 (+) False LOC110513073
TU131145 other upstream 476924 12949360 ~ 12964930 (+) True G114323
TU131068 other upstream 679027 12762232 ~ 12762827 (+) True G114263
TU131041 other upstream 720539 12720730 ~ 12721315 (+) True G114244
TU131040 other upstream 721161 12720408 ~ 12720693 (+) True G114243
TU129672 other upstream 1732077 11708603 ~ 11709777 (+) True G113396
TU131856 other downstream 148230 13621977 ~ 13623965 (+) True LOC110520769
TU131892 other downstream 227863 13701610 ~ 13709374 (+) False LOC110520780
TU132139 other downstream 487514 13961261 ~ 13962812 (+) True LOC110535330
TU132281 other downstream 668135 14141882 ~ 14144267 (+) True G115190
TU132280 other downstream 760767 14234514 ~ 14236854 (+) True G115189

Expression Profile


TU131680 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU131680 Expression in each Bioproject

Bar chart with 20 bars.
TU131680 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.