RNA id: TCONS_00028155


Basic Information

Item Value
RNA id TCONS_00028155
length 309
RNA type mRNA
GC content 0.51
exon number 4
gene id XLOC_014132
representative False

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 30884706 ~ 30895273 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CACGTTTCTCAGCGACCGCCGGTGAGATATAATGTATCAGCAGACATCATGGGAGAGCAGCTGAGTCCTGATGAGAAGTTCCAGCTCATCACCAGAAACCTTCAGGAGGTTCTTGGTGAGGAGAGGTTGAAGGAGATCCTGAAGGAGCGGGAACTGAAGGTTTACTGGGGAACAGCGACTACAGGCAAACCCCATGTTGCTTACTTTGTCCCCATGTCAAAAATTGCTGACTTCCTGAAGGCGGGCTGTGAGGTGACCATCCTCTTTGCTGATCTCCATGCTTATCTGGATAACATGAAGGCTCCCTGG

Function

GO:

id name namespace
GO:0006974 cellular response to DNA damage stimulus biological_process
GO:0006412 translation biological_process
GO:0006418 tRNA aminoacylation for protein translation biological_process
GO:0006437 tyrosyl-tRNA aminoacylation biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0000049 tRNA binding molecular_function
GO:0004812 aminoacyl-tRNA ligase activity molecular_function
GO:0005524 ATP binding molecular_function
GO:0004831 tyrosine-tRNA ligase activity molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0016874 ligase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030425-2 Predicted to enable tyrosine-tRNA ligase activity. Acts upstream of or within cellular response to DNA damage stimulus. Predicted to be located in nucleus. Is expressed in several structures, including hematopoietic system; immature eye; mesoderm; musculature system; and nervous system. Human ortholog(s) of this gene implicated in Charcot-Marie-Tooth disease dominant intermediate C. Orthologous to human YARS1 (tyrosyl-tRNA synthetase 1).

Ensembl:

ensembl_id ENSDART00000139599

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00029724 lncRNA upstream 41764 30841639 ~ 30843233 (+) True XLOC_014130
TCONS_00029956 lncRNA upstream 48792 30832290 ~ 30836205 (+) True XLOC_014129
TCONS_00029955 lncRNA upstream 83009 30800052 ~ 30801988 (+) True XLOC_014128
TCONS_00029723 lncRNA upstream 159294 30724996 ~ 30725703 (+) True XLOC_014127
TCONS_00028143 lncRNA upstream 295046 30587866 ~ 30589951 (+) True XLOC_014124
TCONS_00029725 lncRNA downstream 82072 30969012 ~ 30970025 (+) True XLOC_014133
TCONS_00029957 lncRNA downstream 251887 31138827 ~ 31153090 (+) True XLOC_014137
TCONS_00029958 lncRNA downstream 270707 31157647 ~ 31218099 (+) False XLOC_014138
TCONS_00029959 lncRNA downstream 363980 31250920 ~ 31348348 (+) False XLOC_014139
TCONS_00029960 lncRNA downstream 364001 31250941 ~ 31279906 (+) False XLOC_014139
TCONS_00028148 mRNA upstream 943 30867845 ~ 30884054 (+) False XLOC_014131
TCONS_00028147 mRNA upstream 200123 30662529 ~ 30684874 (+) True XLOC_014126
TCONS_00028146 mRNA upstream 201319 30633453 ~ 30683678 (+) False XLOC_014126
TCONS_00028141 mRNA upstream 368317 30495109 ~ 30516680 (+) True XLOC_014122
TCONS_00028140 mRNA upstream 416763 30450125 ~ 30468234 (+) True XLOC_014121
TCONS_00028159 mRNA downstream 103189 30990129 ~ 30997794 (+) False XLOC_014134
TCONS_00028158 mRNA downstream 103189 30990129 ~ 30997794 (+) False XLOC_014134
TCONS_00028160 mRNA downstream 103875 30990815 ~ 30994160 (+) True XLOC_014134
TCONS_00028161 mRNA downstream 156062 31043002 ~ 31053378 (+) False XLOC_014135
TCONS_00028162 mRNA downstream 157547 31044487 ~ 31054326 (+) True XLOC_014135
TCONS_00028149 other upstream 2541 30879788 ~ 30882456 (+) True XLOC_014131
TCONS_00028145 other upstream 253937 30630943 ~ 30631060 (+) True XLOC_014125
TCONS_00028142 other upstream 366424 30518455 ~ 30518573 (+) True XLOC_014123
TCONS_00028136 other upstream 1024663 29859036 ~ 29860334 (+) True XLOC_014118
TCONS_00028134 other upstream 1024791 29854249 ~ 29860206 (+) False XLOC_014118
TCONS_00028165 other downstream 455083 31342023 ~ 31348348 (+) True XLOC_014139
TCONS_00028174 other downstream 700991 31587931 ~ 31590491 (+) True XLOC_014142
TCONS_00028175 other downstream 704584 31591524 ~ 31591540 (+) True XLOC_014144
TCONS_00028183 other downstream 1171537 32058477 ~ 32058599 (+) True XLOC_014151
TCONS_00028194 other downstream 1927380 32814320 ~ 32818574 (+) True XLOC_014160